Encyclopedia results for thymine

1. Thymine
   
   ImageFileL2 Thymine 3D balls.png ImageSizeL2 100px ImageFileR2 Thymine 3D vdW.png ImageSizeR2 100px ... CASNo 65 71 4 PubChem SMILES CC1 CNC O NC1 O MeSHName Thymine Section2 Chembox Properties ..
   
   
   
   
2. Thymine dimer
   
   A thymine dimer is the covalent bonding of two adjacent thymine residues within a DNA molecule, often ... photolyase s can repair the damage directly by cleaving the dimer. Unrepaired or mis repaired thymine ..
   
   
   
   
3. Thymine dioxygenase
   
   In enzymology , a thymine dioxygenase EC number 1.14.11.6 is an enzyme that catalysis catalyzes the chemical reaction thymine 2 oxoglutarate O sub 2 sub math rightleftharpoons math 5 hydroxymethyluracil ..
   
   
   
   
4. Thymine-DNA glycosylase
   
   PBB geneid 6996 Thymine DNA glycosylase , also known as TDG , is a human gene . ref name entrez cite web title Entrez Gene TDG thymine DNA glycosylase url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ..
   
   
   
   
5. ACGT
   
   for Adenine and pairs with the T, which stands for Thymine . The C stands for Cytosine and pairs ... stands for the four amino acids that make up RNA . RNA pairs up the same as DNA , except that Thymine ..
   
   
   
   
6. TDG
   
   TDG may refer to TDG plc , ex Transport Development Group a British logistics and distribution company Three Days Grace , a rock band Thymine DNA glycosylase , an enzyme disambig Long comment to avoid ...
   
   
   
   
7. List of Y-DNA single nucleotide polymorphisms
   
   Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G 148 287 ..
   
   
   
   
8. Ribonucleotide
   
   A ribonucleotide is a nucleotide in which a purine or pyrimidine base is linked to a ribose molecule . The base may be adenine A , guanine G , cytosine C , or uracil U . Note that thymine T , which is ...
   
   
   
   
9. Nitrogenous base
   
   , triethylamine , pyridine , and the nucleobase s adenine , guanine , thymine , cytosine , and uracil ..
   
   
   
   
10. High-GC content bacteria
    
    High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria   ref NCBI ...
    
    
    
    
11. Spore photoproduct lyase
    
    bacterial spores. The enzyme is radical SAM dependent. Through a series of radical reactions the Thymine ... thymine rings. ref cite journal author Susan C. Wang and Perry A. Frey title S adenosylmethionine ..
    
    
    
    
12. Thymidine
    
    Thymidine more precisely called deoxythymidine can also be labelled deoxyribosylthymine , and thymine ... composition, deoxythymidine is deoxyribose a pentose sugar joined to the pyrimidine base thymine ..
    
    
    
    
13. De novo synthesis
    
    de novo Lodish et al., 2008, Molecular Cell Biology 141 . . pyrimidines cytosine, thymine, uracil ..
    
    
    
    
14. Dihydropyrimidine dehydrogenase
    
    of uracil and thymine . It is also involved in the degradation of the chemotherapeutic drugs ..
    
    
    
    
15. Recognition sequence
    
    5 G T GGGCGG G A G A C T 3 , where G T indicates that the domain will bind a guanine or thymine ..
    
    
    
    
16. 3-Aminoisobutyric acid
    
    3 Aminoisobutyric acid is a product formed by the catabolism of thymine . DEFAULTSORT Aminoisobutyric ..
    
    
    
    
17. Dihydrothymine
    
    MainHazards FlashPt Autoignition Dihydrothymine is an intermediate in the metabolism of thymine . organic ..
    
    
    
    
18. Pribnow box
    
    The Pribnow box also known as the Pribnow Schaller box is the sequence TATAAT of six nucleotide s thymine adenine thymine etc. that is an essential part of a promoter site on DNA for Transcription genetics ..
    
    
    
    
19. Ada (protein)
    
    6 sup alkyl guanine or thymine O sup 4 sup alkyl thymine and to the oxygen of the phosphodiester backbone ... compared to either O sup 4 sup thymine and alkylated phosphotriesters. Ada enzyme has two active sites ..
    
    
    
    
20. Genetics glossary
    
    nucleotide bases in DNA DNA or RNA RNA pairs with thymine thymine in DNA or uracil uracil in RNA. span ... inside the cell biology cell . T span id thymine span Thymine One of the four nucleotide nucleotide ..
    
    
    
    
21. QMC@Home
    
    aminopyridine 7a Adenine 7b Thymine 7 Adenine thymine WC 8a Methane 8 Methane dimer 9a Ethene 9 Ethene ... 14a Indole 14 Indole benzene 15 Adenine thymine stack 16b Ethine 16 Ethene ethine 17 Benzene water ..
    
    
    
    
22. Ogt
    
    for the removal of alkyl groups from O sup 6 sup alkyl guanine , O sup 4 sup alkyl thymine ... a greater preference for O sup 4 sup alkyl thymine than O sup 6 sup alkyl guanine and alkyl phosphotriester ..
    
    
    
    
23. Nucleic acid nomenclature
    
    an adenine nucleotide is abbreviated as A , guanine as G , cytosine as C , thymine as T , and in RNA ..
    
    
    
    
24. Thymidine monophosphate
    
    Functional group group , the pentose sugar deoxyribose , and the nucleobase thymine . See also Nucleoside ..
    
    
    
    
25. 5-Methyluridine
    
    Image T chemical structure.png thumb 150px right The structure of 5 methyluridine The chemical Chemical compound compound 5 methyluridine also called ribosylthymine , thymine riboside , and m5u is a p ...
    
    
    
    

Articles 1 - 25 of 211          Next

Search   in   Tutorials Encyclopedia Dictionary Directory

Search for thymine in Tutorials

Search for thymine in Encyclopedia

Search for thymine in Dictionary

Search for thymine in Open Directory

Search for thymine in Store

Search for thymine in PriceGig

Help build the largest human-edited directory on the web. Submit a Site - Open Directory Project - Become an Editor