Guanine
chembox ImageFile1 Guanine chemical structure.png ImageSize1 150px ImageFileL2 Guanine 3D balls.png ImageSizeL2 100px ImageFileR2 Guanine 3D vdW.png ImageSizeR2 100px IUPACName 2 amino 1 H purin 6 9 H ..
Guanine deaminase
protein Name guanine deaminase caption image width HGNCid 4212 Symbol GDA AltSymbols EntrezGene 9615 ... 21.33 Guanine deaminase or guanine aminohydrolase is an enzyme which converts guanine ..
Guanine-transporting ATPase
In enzymology , a guanine transporting ATPase EC number 3.6.3.37 is an enzyme that catalysis catalyzes ... sub 2 sub O , and guanine , whereas its 3 product chemistry products are adenosine diphosphate ADP ..
Hypoxanthine-guanine phosphoribosyltransferase
. PBB geneid 3251 Hypoxanthine guanine phosphoribosyltransferase HPRT ref name Entrez cite web ... guanine guanosine monophosphate often renamed as HGPRT. Only performs this function in some species ..
Guanine nucleotide exchange factor Guanine nucleotide exchange factors GEFs are components of intracellular cell signalling signalling networks ... G protein s. Kalirin GNOM Arabidopsis thaliana See also nucleotide exchange factor guanine ..
Guanín
Guanín may refer to Guanín Taino Guanín bronze Guanine disambig Long comment to avoid being listed on short pages ..
Phosphoribosyltransferase
Phosphoribosyltransferase may refer to Adenine phosphoribosyltransferase Hypoxanthine guanine phosphoribosyltransferase Orotidine 5 phosphate decarboxylase Uracil phosphoribosyltransferase disambig ..
GNE
GNE gene , a human gene Guanine nucleotide exchange factor Guanine Nucleotide Exchange biology disambig ..
Ras-GRF1
protein Name Ras protein specific guanine nucleotide releasing factor 1 caption image width HGNCid 9875 ... Chromosome 15 Arm q Band 24 LocusSupplementaryData Ras GRF1 is a guanine nucleotide exchange ..
List of Y-DNA single nucleotide polymorphisms
Position Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag ... M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg ..
Base analog
, guanine . If this happens during DNA replication, a guanine will be inserted opposite the base analog, and in the next DNA replication, that guanine will pair with a cytosine. This results ..
Queuine tRNA-ribosyltransferase
the chemical reaction tRNA guanine queuine math rightleftharpoons math tRNA queuine guanine Thus, the two substrate biochemistry substrates of this enzyme are tRNA guanine and queuine , whereas ..
GEF
GEF or Gef may refer to Gef the talking mongoose , a famed poltergeist story from the Isle of Man Global Environment Facility Graphical Editing Framework Guanine nucleotide exchange factor , activator ...
Pentosyltransferases
Pentosyltransferases are a type of glycosyltransferase that catalyze the transfer of a pentose . Examples include adenine phosphoribosyltransferase hypoxanthine guanine phosphoribosyltransferase pertu ...
Inosine-5?-monophosphate dehydrogenase
Inosine 5 monophosphate dehydrogenase IMPDH is an enzymne which salvages purine s to make guanine in the human pathogen Cryptosporidium parvum . The C. parvum enzyme IMPDH differs enough from human IMPDH ..
Tetraloop
has a guanine adenine base pair where the guanine is 5 to the helix and the adenine is 3 to the helix ..
Tioguanine
antimetabolite s. It is a guanine analog. Its principal use is in acute leukaemia s and chronic myeloid leukaemia . Pharmacology As a guanine analogue, it is transformed inside the cell into to 6 thioguanilyic ..
Ogt
O sup 6 sup alkyl guanine transferase II O sup 6 sup AGT II previously known as O sup 6 sup Guanine transferase ... for the removal of alkyl groups from O sup 6 sup alkyl guanine , O sup 4 sup alkyl thymine ..
Depurination
Depurination is a DNA alteration in which the hydrolysis of a purine base Adenine or Guanine from the deoxyribose ... ring has a hydroxyl OH group in the place of the Adenine or Guanine. Around 1,000 Purines ..
GRR
containing multiple copies of the amino acid glycine Guanine rich region, a stretch of desoxyribonucleic acid DNA containing multiple copies of the nucleotide guanine Great River Road grr may refer ..
Ribonucleotide
A ribonucleotide is a nucleotide in which a purine or pyrimidine base is linked to a ribose molecule . The base may be adenine A , guanine G , cytosine C , or uracil U . Note that thymine T , which is ...
Nitrogenous base
, triethylamine , pyridine , and the nucleobase s adenine , guanine , thymine , cytosine , and uracil ..
Vav
. Vav protein Vav proteins, a family of guanine nucleotide exchange factors involved in cell signalling ..
Encyclopedia
top
