Refimprove date December 2009 Endonucleases are enzyme s that cleave the phosphodiester bond within a polynucleotide chain, in contrast to exonuclease s, which cleave phosphodiester bond s at the end of a polynucleotide chain. Restriction endonucleases Restriction enzyme s cleave DNA at specific sites, and are divided into three categories, Type I, Type II, and Type III, according to their mechanism of action. These enzymes are often used in genetic engineering to make recombinant DNA for introduction into bacterial, plant, or animal cells. Common endonucleases Restriction endonucleases ENases are most commonly produced by bacteria, and can be used to map a piece of DNA. ENases are widespread amongst prokaryotes bacteria and archaea , but are produced by some eukaryotic organisms as well, although this is very rare. ref Madigan, Michael T., John M. Martinko, Thomas D. Brock, and David P. Clark. Biology of Microorganisms. 12th ed. San Francisco, CA Pearson Benjamin Cummings, 2009. Print. p. 314 ref Some endonucleases have actions on RNA, such as the Dicer enzyme, which initiates the formation of RNA induced silencing complexes. These may also be termed endoribonuclease s. Bacterial UvrABC endonuclease is a well documented endonuclease found in E.coli . See also Exonuclease Nuclease Ribonuclease Nucleases Reflist Category EC 3.1 Hydrolase stub ca Endonucleasa de Endonuklease fa fr Endonucl ase it Endonucleasi pl Endonukleazy ru tr Endon kleaz uk zh ... more details
UvrABC endonuclease is a multienzyme complex in Escherichia coli E.coli bacteria involved in DNA repair mechanism by nucleotide excision repair , and it is, therefore, sometimes called an excinuclease . This UvrABC repair process, sometimes called the short patch process, involves the removal of 12 nucleotides where a genetic mutation has occurred followed by a DNA polymerase, replacing these aberrant nucleotides with the correct nucleotides and completing the DNA repair . This enzyme complex is able to repair many different types of damage, including cyclobutyl dimer formation. Mechanism Two UvrA proteins form a dimer and they both have ATPase GTPase activity. The UvrA protein dimer dimer binds with UvrB and forms a protein trimer trimer that is able to detect DNA damage .The UvrA dimer functions as the unit responsible for the detection of DNA damage, probably through a mechanism of detecting distortions in the DNA double helix . The UvrB part of the trimer attaches to the double helix at the damaged site. The UvrA dimer leaves and an UvrC protein comes in and binds to the UvrB monomer and, hence, forms a new UvrBC dimer. This dimer is responsible for cleaving the nucleotides either side of the DNA damage. UvrB cleaves a phosphodiester bond 4 nucleotides downstream of the DNA damage, and the UvrC cleaves a phosphodiester bond 8 nucleotides upstream of the DNA damage and created 12 nucleotide excised segment. DNA helicase II sometimes called UvrD then comes in and removes the excised segment by removing the base pairing. The UvrB still remain in place even though UvrC has disassociated at this stage, as UvrB may be involved to prevent the reannealing of the excised DNA. DNA polymerase I comes in and fills in the correct nucleotides sequence, kicking off UvrB in the process, and the last phosphodiester bond is completed by DNA ligase. See also DNA repair endonuclease Nucleotide excision repair DNA External links MeshName uvrABC endonuclease Nucleases Enzyme stub Genetics ... more details
they facilitate the perpetuation of the genetic elements that encode them. Homing endonuclease recognition ... found in only one instance per genome . Generally, the gene encoding the endonuclease the HEG, homing endonuclease gene is located within the recognition sequence which the enzyme cuts, thus ..., HEG sup sup , that contains the gene for the endonuclease. Thus, the gene is copied to the allele ... cite journal author Burt A, Koufopanou V title Homing endonuclease genes the rise and fall and rise ... BL title Design, activity, and structure of a highly specific artificial endonuclease journal ... endonuclease journal Moll Cell volume 10 issue 4 pages 895 905 month October pmid 12419232 year 2002 doi 10.1016 S1097 2765 02 00690 1 ref the first synthetic homing endonuclease, created in a laboratory ..., Monnat RJ, Stoddard BL title DNA recognition and cleavage by the LAGLIDADG homing endonuclease I CreI ... SceI endonuclease, an enzyme generated by protein splicing journal J Mol Biol volume 263 issue ... of a DNA endonuclease involved in intron mobility journal Cell volume 83 issue 4 month November ... size 86 Dimer of the I CreI homing endonuclease. ref name pmid9809068 Alpha helix Alpha helices are shown ... References Reflist See also List of homing endonuclease cutting sites . I CreI I CreI homing endonuclease . Meganucleases . Restriction enzyme . Intron s and intein s. Intragenomic conflict Homing endonuclease genes Intragenomic conflict Homing endonuclease genes . Transposon . DEFAULTSORT Homing Endonuclease ... more details
Flap endonucleases FENs, also known as 5 nucleases in older references are a class of nucleolytic enzymes that act as both Directionality molecular biology 5 3 exonucleases and structure specific endonucleases on specialised DNA structures that occur during the biological processes of DNA replication , DNA repair and DNA recombination. Flap endonucleases have been identified in eukaryotes , prokaryotes , archaea and some virus es. Organisms can have more than one FEN Homology biology homologue , this redundancy may give an indication of the importance of these enzymes. In prokaryotes, the FEN enzyme is found as an N terminus N terminal domain of DNA polymerase I, but some prokaryotes appear to encode a second homologue. ref Sayers JR 1994 J Theor Biol, 170 4 415. PMID 7996866 ref The endonuclease activity of FENs was initially identified as acting on a DNA duplex which has a single stranded 5 overhang on one of the strands termed a 5 flap , hence the name flap endonuclease ref Harrington JJ and Lieber MR 1994 EMBO J., 13 , 1235 1246. PMID 8131753 ref . FENs catalyse hydrolytic cleavage of the phosphodiester bond at the junction of single and double stranded DNA. FENs can also act as 5 3 exonucleases on the 5 terminus of the flap strand and on nicked DNA Substrate biochemistry substrate s. Protein structure models based on X ray crystallography data suggest that FENs have a flexible arch created by two helices through which the single 5 strand of the 5 flap structure can thread ref Ceska TA et al., 1996 Nature, 382 , 90 93. PMID 8657312 ref . Flap endonucleases have been used in biotechnology , for example the Taqman PCR assay ref http www.med.unc.edu anclinic Tm.htm Taqman Principles Bot generated title ref and the Invader single nucleotide polymorphism SNP assay ref Olivier M 2005 Mutat. Res. 573 , 103 110. PMID 15829241 ref . For a more detailed reviews of FENs see ref Liu Y et al. , 2004 Annu. Rev. Biochem., 73 , 589 615. PMID 15189154 ref ref Ceska TA and Saye ... more details
endonuclease from HeLa cells References Molecular graphics images were produced using the UCSF .... 25 volume 12 pages 1605 1612 year 2004 ref reflist DEFAULTSORT Ap Endonuclease Category Enzymes ... more details
Mung bean endonuclease is a single strand specific DNA and RNA endonuclease which will degrade single stranded extensions from the ends of DNA and RNA molecules, leaving blunt, ligatable ends. ref http www.neb.com nebecomm products productm0250.asp ref References reflist refbegin http www.neb.com nebecomm products productm0250.asp refend Category Enzymes enzyme stub ... more details
Pfam box Symbol Exo endo phos Name Endonuclease Exonuclease phosphatase family image PDB 1ako EBI.jpg width caption Structure of the multifunctional DNA repair enzyme exonuclease III. ref name pmid7885481 cite journal author Mol CD, Kuo CF, Thayer MM, Cunningham RP, Tainer JA title Structure and function of the multifunctional DNA repair enzyme exonuclease III journal Nature volume 374 issue 6520 pages 381 6 year 1995 month March pmid 7885481 doi 10.1038 374381a0 url ref Pfam PF03372 InterPro IPR005135 SMART Prosite PDOC00598 SCOP 1ako TCDB OPM family 148 OPM protein 1zwx PDB PDB3 1i9y A 560 846 PDB3 1i9z A 560 846 PDB3 1si6 X 29 298 PDB3 1y21 A 29 298 PDB3 1ntf A 29 298 PDB3 1zwx A 45 332 PDB3 1ako 1 266 PDB3 1de9 A 62 316 PDB3 1de8 A 62 316 PDB3 1cqg B 62 70 PDB3 1dew A 62 316 PDB3 1cqh B 62 70 PDB3 1e9n A 62 316 PDB3 1hd7 A 62 316 PDB3 1bix 62 316 PDB3 1lyr A 62 316 PDB3 1xzs A 62 316 PDB3 1xzr A 62 316 PDB3 1xzt A 62 316 PDB3 1wdu B 56 180 PDB3 1sr4 B 27 281 PDB3 2a41 B 23 281 PDB3 1dnk A 23 281 PDB3 2a40 B 23 281 PDB3 2dnj A 23 281 PDB3 2a3z B 23 281 PDB3 3dni 23 281 PDB3 1atn D 23 281 PDB3 2a42 B 23 281 Endonuclease Exonuclease phosphatase family is a structural domain found in the large family of proteins including magnesium dependent endonucleases and many phosphatase s involved in intracellular signaling . ref name PUB00007746 cite journal author Dlaki M title Functionally unrelated signalling proteins contain a fold similar to Mg2 dependent endonucleases journal Trends Biochem. Sci. volume 25 issue 6 pages 272 273 year 2000 pmid 10838565 doi 10.1016 S0968 0004 00 01582 6 ref Examples AP endonuclease proteins EC number 4.2.99.18 , DNase I proteins EC number 3.1.21.1 , Synaptojanin , an inositol 1,4,5 trisphosphate phosphatase EC number 3.1.3.56 Sphingomyelinase EC number 3.1.4.12 and Nocturnin UniProt O35710 . Subfamilies Inositol polyphosphate related phosphatase InterPro IPR000300 Human proteins containing this domain 2 PDE 2 PDE ANGEL1 ANGEL2 APEX1 APEX2 ... more details
PBB geneid 2237 Flap endonuclease 1 is an enzyme that in humans is encoded by the FEN1 gene . ref name pmid7774922 cite journal author Hiraoka LR, Harrington JJ, Gerhard DS, Lieber MR, Hsieh CL title Sequence of human FEN 1, a structure specific endonuclease, and chromosomal localization of the gene FEN1 in mouse and human journal Genomics volume 25 issue 1 pages 220 5 year 1995 month Jul pmid 7774922 pmc doi 10.1016 0888 7543 95 80129 A ref ref name entrez cite web title Entrez Gene FEN1 flap structure specific endonuclease 1 url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch ... endonuclease 1 during long patch base excision repair provides coordinated loading of the proteins onto ... RAD2 endonuclease family and is one of ten proteins essential for cell free DNA replication ... structure specific endonuclease 1 has been shown to Protein protein interaction interact with Cyclin ... 2001 month Jun. title Regulation of human flap endonuclease 1 activity by acetylation through the transcriptional ... Ian D, Brosh Robert M year 2004 month Mar. title Stimulation of flap endonuclease 1 by the Bloom ... flap endonuclease 1 and stimulates its cleavage activity journal EMBO J. volume 20 issue 20 pages 5791 ... M S year 1997 month Sep. title The DNA repair endonuclease XPG binds to proliferating cell nuclear ... AP endonuclease 1 with flap endonuclease 1 and proliferating cell nuclear antigen involved in long ... flap endonuclease 1 is critical for substrate binding and catalysis. journal J. Biol. Chem. volume ... DNA structure specific endonuclease. journal EMBO J. volume 13 issue 5 pages 1235 46 year 1994 pmid ... acids for substrate binding and catalysis of human flap endonuclease 1. journal J. Biol. Chem. volume ... pmc 1169950 cite journal author Gary R, Ludwig DL, Cornelius HL, et al. title The DNA repair endonuclease ... and replication endonuclease and exonuclease FEN 1 coupling DNA and PCNA binding to FEN 1 activity .... title Regulation of human flap endonuclease 1 activity by acetylation through the transcriptional coactivator ... more details
endonuclease . TOC Homing endonucleases The list includes some of the most studied examples. The following ... endonuclease Nomenclature Nomenclature in the article Homing endonuclease . SF Structural family Any ... see the section homing endonuclease Structural families Structural families in the article Homing endonuclease . PDB code Code used to identify the structure of a protein in the Protein Data Bank ... strand endonuclease that cleaves the homing site of this intron journal Curr Genet volume 19 issue ... cite journal author Marshall P, Lemieux C title Cleavage pattern of the homing endonuclease encoded ... rrnL gene of Chlamydomonas humicola encodes a site specific DNA endonuclease I ChuI journal ... author Turmel M, Mercier JP, C t V, Otis C, Lemieux C title The site specific DNA endonuclease ... by the LAGLIDADG homing endonuclease I CreI journal Moll Cell volume 2 issue 4 month October pages ..., activity, and structure of a highly specific artificial endonuclease journal Moll Cell volume 10 ... code br code 3 TCATTACTCGGATTGCGAGTCGTT Pad em Nicking endonuclease br code Pad 2em 3 TCATTACTCGGATTGC ... Pad em Nicking endonuclease br code Pad 2em 3 TCATTACTCGGATTGCGAGTTGTTN sub 35 sub ... type endonuclease from Pyrobaculum organotrophum journal Nucleic Acids Res pmid 7984405 volume 22 ... in the S.cerevisiae bi2 intron encoded RNA maturase is sufficient to gain a homing endonuclease activity ... name pmid1534148 cite journal author Gimble FS, Thorner J title Homing of a DNA endonuclease gene by meiotic ... J, Banroques J, Jacq C title Site specific DNA endonuclease and RNA maturase activities of two homologous ... D, Tian GL, Lazowska J, Jacq C title A new specific DNA endonuclease activity in yeast mitochondria ... C title I Sce III a novel group I intron encoded endonuclease from the yeast mitochondria journal ... mitochondrial intron aI5 alpha associated endonuclease activity and in vivo mobility journal ... AM, Maley F title Characterization of the restriction site of a prokaryotic intron encoded endonuclease ... more details
Endodeoxyribonuclease is a endonuclease ribonuclease . Restriction enzyme s are a type of endodeoxyribonuclease. More examples Deoxyribonuclease I, Deoxyribonuclease II, Deoxyribonuclease IV, UvrABC endonuclease External links MeshName Endodeoxyribonucleases Nucleases hydrolase stub Category Ribonucleases ... more details
NOTOC Wiktionary domain HEG may refer to Homing endonuclease genes , the genes that codes for the homing endonucleases Hydro erosive grinding , a process of calibration of machines that works with fluids disambig ... more details
Endodeoxyribonucleases are enzymes which are both deoxyribonuclease s and endonuclease s. They are classified with EC number s 3.1.21 through 3.1.25. Examples include restriction enzymes DNA restriction enzymes micrococcal nuclease External links MeshName Endodeoxyribonucleases Category EC 3.1 enzyme stub ... more details
Orphan date February 2009 Meganuclease I Sce I is a homing endonuclease . It recognises an 18 base pair sequence TAGGGATAACAGGGTAAT and leaves a 4 base pair 3 hydroxyl overhang. It is a rare cutting endonuclease . Statistically an 18 bp sequence will occur once in every 6.9 10 sup 10 sup base pairs or once in 20 human genomes. ref http www.neb.com nebecomm products productR0694.asp New England Biolabs site ref Source I SceI is coded by intron s. It is present in the mitochondria of yeast Saccharomyces cerevisiae . References Reflist Category Molecular biology Category Biotechnology Category Restriction enzymes molecular cell biology stub ... more details
WG date 1987 title Escherichia coli endonuclease III is not an endonuclease but a beta elimination ... journal author PH date 1988 title Mechanism of UV endonuclease V cleavage of abasic sites in DNA ... more details
Unreferenced stub auto yes date December 2009 Orphan date November 2006 NlaIII is an endonuclease that cleaves double stranded DNA molecules into fragments, leaving leave 3 overhangs of four nucleotides at the ends of each fragment. DEFAULTSORT Nlaiii Category Genetics Category Molecular biology Category Biotechnology Category Restriction enzymes Genetics stub ... more details
Taken from Jurica MS, Monnat RJ, Stoddard BL. 1998 DNA Recognition and Cleavage by the LAGLIDADG Homing Endonuclease I Cre I. Molecular Cell . 2 469 476. Copyright 1998 Cell Press. Fair use rationale this is only one figure out of the Jurica et al . paper, and it therefore does not threaten the market for the paper. There is no reasonable substitute for this figure in the Wikipedia I Cre I article. It is used for educational purposes and not for commercial purposes. Non free fair use in I CreI ... more details
A Endoribonuclease is a ribonuclease endonuclease . It cleaves either single or double stranded RNA depending on the enzyme. Example includes both single proteins like RNase III , RNase A , RNase T1 and RNase H but also, complexes of proteins like RNase P and the RNA induced silencing complex . External links MeshName Endoribonucleases hydrolase stub Nucleases Category Ribonucleases fr Endoribonucl ase ... more details
LtrA is an Open Reading Frame found in the Lactococcus lactis group II intron s LtrB. It is an intron encoded protein, which consists of three subdomains a reverse transcriptase maturase, DNA endonuclease, and DNA RNA binding domain. LtrA helps to capture and stabilize the catalytically active conformation of the LtrB group II intron RNA. It also functions in group II intron retrohoming. References http beta.uniprot.org uniprot P0A3U0 UniProtKB Group II intron encoded protein ltrA Category Molecular biology ... more details
Notability date May 2009 Orphan date February 2009 NdeI is an endonuclease isolated from Neisseria denitrificans . In molecular biology , it is commonly used as a restriction enzyme . Recognition sequence of NdeI 5 CATATG 3 GTATAC How NdeI cuts this sequence 5 CA TATG 3 3 GTAT AC 5 Category Molecular biology Category Bacterial enzymes Category Restriction enzymes enzyme stub ... more details
Orphan date February 2009 PBB geneid 4913 Endonuclease III like protein 1 is an enzyme that in humans is encoded by the NTHL1 gene . ref name pmid9045706 cite journal author Hilbert TP, Chaung W, Boorstein RJ, Cunningham RP, Teebor GW title Cloning and expression of the cDNA encoding the human homologue of the DNA repair enzyme, Escherichia coli endonuclease III journal J Biol Chem volume 272 issue 10 pages 6733 40 year 1997 month Apr pmid 9045706 pmc doi 10.1074 jbc.272.10.6733 ref ref name pmid8990169 cite journal author Aspinwall R, Rothwell DG, Roldan Arjona T, Anselmino C, Ward CJ, Cheadle JP, Sampson JR, Lindahl T, Harris PC, Hickson ID title Cloning and characterization of a functional human homolog of Escherichia coli endonuclease III journal Proc Natl Acad Sci U S A volume 94 issue ... cite web title Entrez Gene NTHL1 nth endonuclease III like 1 E. coli url http www.ncbi.nlm.nih.gov ... homologue of Escherichia coli endonuclease III identification of a bovine pyrimidine hydrate thymine ... NTH1, a homolog of Escherichia coli endonuclease III. Direct identification of Lys 212 as the active ... Cloning and characterization of a mouse homologue mNthl1 of Escherichia coli endonuclease III. journal ... homologue NTHL1 NTH1 of Escherichia coli endonuclease III with those of the adjacent parts of TSC2 ... S0378 1119 98 00485 5 cite journal author Bessho T title Nucleotide excision repair 3 endonuclease ... endonuclease III hNTH1 . journal J. Mol. Biol. volume 321 issue 2 pages 265 76 year 2002 pmid 12144783 ... al. title Substrate specificity of human endonuclease III hNTH1 . Effect of human APE1 on hNTH1 activity ... localization of the human and mouse endonuclease III homologs and analysis of the sorting signals ... of human endonuclease III stimulates its activity. journal J. Biol. Chem. volume 278 issue 50 ... T, Masaoka A, et al. title Differential specificity of human and Escherichia coli endonuclease ... JB, Kedar P, et al. title AP endonuclease independent DNA base excision repair in human cells. journal ... more details
Orphan date February 2009 PBB geneid 2021 Endonuclease G, mitochondrial is an enzyme that in humans is encoded by the ENDOG gene . ref name pmid7789991 cite journal author Tiranti V, Rossi E, Ruiz Carrillo A, Rossi G, Rocchi M, DiDonato S, Zuffardi O, Zeviani M title Chromosomal localization of mitochondrial transcription factor A TCF6 , single stranded DNA binding protein SSBP , and endonuclease G ENDOG , three human housekeeping genes involved in mitochondrial biogenesis journal Genomics volume 25 issue 2 pages 559 64 year 1995 month Jul pmid 7789991 pmc doi 10.1016 0888 7543 95 80058 T ref ref name entrez cite web title Entrez Gene ENDOG endonuclease G url http www.ncbi.nlm.nih.gov sites entrez?Db gene&Cmd ShowDetailView&TermToSearch 2021 accessdate ref The PBB Summary template is automatically maintained by Protein Box Bot. See Template PBB Controls to Stop updates. PBB Summary section title summary text The protein encoded by this gene is a nuclear encoded endonuclease that is localized in the mitochondrion. The encoded protein is widely distributed among animals and cleaves DNA ... to initiate replication of mitochondrial DNA. ref name entrez cite web title Entrez Gene ENDOG endonuclease ... author Prats E, No l M, L tourneau J, et al. title Characterization and expression of the mouse endonuclease ... 10.1089 dna.1997.16.1111 cite journal author Li LY, Luo X, Wang X title Endonuclease G is an apoptotic ... Mammalian mitochondrial endonuclease G. Digestion of R loops and localization in intermembrane space ... stress related impairment of mitochondria and relocation of endonuclease G and apoptosis inducing ... involvement of caspase 3 and endonuclease G. journal J. Neurovirol. volume 10 issue 3 pages ... M, et al. title Regulation of the human apoptotic DNase RNase endonuclease G involvement of Hsp70 ... 005 0410 9 cite journal author Basnakian AG, Apostolov EO, Yin X, et al. title Endonuclease G promotes ... analyses of the cellular localization of the apoptotic proteins endonuclease G, AIF, and AMID ... more details
TaqI is a restriction enzyme isolated from the bacterium Thermus aquaticus in 1978. ref cite journal year 1978 first S. last Sato title A single cleavage of Simian virus 40 SV40 DNA by a site specific endonuclease from Thermus aquaticus, Taq I journal J. Biochem Tokyo month February volume 83 issue 2 pages 633 5 ref It has a recognition sequence of 5 TCGA 3 AGCT and makes the cut 5 T CGA 3 3 AGC T 5 References references Category Restriction enzymes Category Bacterial enzymes ja TaqI pt TaqI sv TaqI ... more details
Orphan date September 2010 Unreferenced date April 2010 Very short patch VSP repair is a DNA repair system that removes GT mismatches created by the deamination of 5 methylcytosine to thymine . This system exists because the glycosylases which normally target deaminated bases cannot target thymine it being one of the regular four bases in DNA . The components of the system are MutS, which binds to the GT mismatch, the Vsr endonuclease, which cuts the DNA, and MutL, which recruits the UvrD helicase. Category DNA repair genetics stub DNA repair ... more details
File Apoptotic DNA Laddering.png alt White DNA bands against a dark grey background, resembling the rungs of a ladder thumb right upright DNA laddering left visualised in an agarose gel by ethidium bromide staining. A Base pair Length measurements 1 kb DNA ladder marker middle and Scientific control control DNA right are included. DNA laddering is a phenomenon seen in laboratory tests it is a sensitive indicator of programmed cell death , specifically of apoptosis . It was first described in 1980 by A. H. Wyllie at the University of Edinburgh Medical School . ref cite journal author Wyllie AH date 1980 04 10 title Glucocorticoid induced thymocyte apoptosis is associated with endogenous endonuclease activation journal Nature journal Nature volume 284 issue 5756 pages 555 556 issn 0028 0836 doi 10.1038 284555a0 pmid 6245367 url http www.nature.com nature journal v284 n5756 abs 284555a0.html ref Endonuclease activation is a characteristic feature of apoptosis. This degrades genomic DNA at internucleosomal linker regions and produces 180 to 185 base pair DNA fragments. On Agarose gel electrophoresis , these give a characteristic laddered appearance. The dying cell s Morphology biology morphological changes are short lived and difficult to detect. DNA laddering has therefore become a sensitive method to distinguish apoptosis from Ischemia ischemic or necrosis toxic cell death . ref cite journal author Iwata M, Myerson D, Torok Storb B, Zager RA. year 1994 month December title An evaluation of renal tubular DNA laddering in response to oxygen deprivation and oxidant injury journal Journal of the American Society of Nephrology volume 5 issue 6 pages 1307 1313 issn 1046 6673 doi pmid 7893995 url http jasn.asnjournals.org cgi content abstract 5 6 1307 ref References reflist See also Apoptosis DNA fragmentation Endonuclease TUNEL assay Category Apoptosis Category Biological techniques and tools Category Cell biology Category Electrophoresis Category Laboratory techniques Cate ... more details
HNH Endonuclease Associated RNA and ORF HEARO RNAs conform to a conserved RNA structure that was identified in bacteria by bioinformatics . ref name Weinberg2009 cite journal author Weinberg Z, Perreault J, Meyer MM, Breaker RR title Exceptional structured noncoding RNAs revealed by bacterial metagenome analysis journal Nature volume 462 issue 7273 pages 656 9 year 2009 month December pmid 19956260 doi 10.1038 nature08586 url ref HEARO RNAs average roughly 300 nucleotides, which is comparable to the size of many ribozymes , which catalysis catalyze chemical reactions. Multiple lines of non experimental evidence suggest that HEARO RNAs form part of a mobile genetic element . HEARO RNAs contain an open reading frame ORF that usually codes for a protein containing an HNH endonuclease domain. Members of this family of endonuclease s are often used by mobile genetic elements, such as group I catalytic intron group I and group II intron s, to facilitate their replication. Several instances were detected of homologous sequences where only one sequence contains the HEARO element, suggesting that the HEARO element might have integrated into an ancestor of this sequence. Such cases also suggest that HEARO elements integrate 5 to ATGA or GTGA sequences, although no other integration requirements were elucidated. Additional analysis was consistent with the hypothesis of self replication. ref name Weinberg2009 The Rfam model of HEARO RNAs uses only the region that is 5 to the ORF. This region includes the bulk of the structure, but does not include a hairpin located 3 to the ORF. References reflist 2 Category Non coding RNA molecular cell biology stub ... more details