Encyclopedia results for cytosine

1. Cytosine
   
   chembox ImageFile1 Cytosine chemical structure.png ImageSize1 150px ImageFileL2 Cytosine 3D balls.png ImageSizeL2 100px ImageFileR2 Cytosine 3D vdW.png ImageSizeR2 100px IUPACName 4 amino 1H pyrimidine ..
   
   
   
   
2. Cytosine deaminase
   
   In enzymology , a cytosine deaminase EC number 3.5.4.1 is an enzyme that catalysis catalyzes the chemical reaction cytosine H sub 2 sub O math rightleftharpoons math uracil NH sub 3 sub Thus, the two substrate ..
   
   
   
   
3. Methylase
   
   cytosine cytosine residues and adenine adenine residues in DNA . See also Demethylase transferase ..
   
   
   
   
4. Pyrimidinones
   
   Image Pyrimidine chemical structure.png thumb Pyrimidine Image Cytosine chemical structure.png thumb Cytosine Image Metharbital.png thumb Metharbital Pyrimidinones are derivatives of pyrimidine which have ..
   
   
   
   
5. Deamination
   
   in DNA Cytosine Image DesaminierungCtoU.png 250px right Spontaneous deamination is the hydrolysis reaction of cytosine into uracil , releasing ammonia in the process. This can occur in vitro through ..
   
   
   
   
6. RasiRNA
   
   methylating the cytosine nucleotides in DNA, which indicates to the cell to package the DNA in the form ..
   
   
   
   
7. Methylome
   
   Methylome is the totality of methylated DNA sites and the pattern of a genome. It comprises all the positions of methylated cytosine mC on healthy DNA. A methylome is a unit that reflects an epigeneti ...
   
   
   
   
8. List of Y-DNA single nucleotide polymorphisms
   
   Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine ... ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M268 M285 Guanine G to Cytosine C 70 287 ttatcctgagccgttgtccctg ..
   
   
   
   
9. CpG site
   
   Image Cytosine chemical structure.png thumb right 100px Cytosine Image Phosphate.png thumb right 125px Phosphate Image Guanine chemical structure.png thumb Guanine CpG sites are regions of DNA where a cytosine ..
   
   
   
   
10. 5-Methylcytosine
    
    Autoignition 5 Methylcytosine is a methylation methylated form of cytosine in which a methyl group ... spontaneous deamination of cytosine forms uracil, which is recognized and removed by DNA repair ..
    
    
    
    
11. Transition (genetics)
    
    pyrimidine nucleotide Cytosine C Thymine T . Approximately two out of every three single nucleotide ... unmethylated cytosine , due to spontaneous deamination . Fact taken from 5 Methylcytosine and deamination ..
    
    
    
    
12. Ribonucleotide
    
    A ribonucleotide is a nucleotide in which a purine or pyrimidine base is linked to a ribose molecule . The base may be adenine A , guanine G , cytosine C , or uracil U . Note that thymine T , which is ...
    
    
    
    
13. Nitrogenous base
    
    , triethylamine , pyridine , and the nucleobase s adenine , guanine , thymine , cytosine , and uracil ..
    
    
    
    
14. ACGT
    
    Unreferenced date February 2007 ACGT stands for the four nucleic acid bases that make up DNA . The A stands for Adenine and pairs with the T, which stands for Thymine . The C stands for Cytosine and p ...
    
    
    
    
15. High-GC content bacteria
    
    High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria   ref NCBI Taxonomy ..
    
    
    
    
16. Lysidine
    
    pairing than cytosine , allowing better translation fidelity. Category Nucleic acids biochemistry ..
    
    
    
    
17. Pyrimidine analogue
    
    FUDR Cytosine arabinoside Cytarabine gallery Image Pyrimidin.svg Pyrimidine Image Fluorouracil.svg ..
    
    
    
    
18. De novo synthesis
    
    de novo Lodish et al., 2008, Molecular Cell Biology 141 . . pyrimidines cytosine, thymine, uracil ..
    
    
    
    
19. Hyper-IgM syndrome type 5
    
    cytosine to uracil. In both type 2 and type 5 hyper IgM syndromes, the patients are profoundly ..
    
    
    
    
20. Oxidative deamination
    
    Oxidative deamination is a form of deamination that generates oxoacid s in the liver . The presence of nitrous acid can cause Transition genetics transition mutations , by converting cytosine to uraci ...
    
    
    
    
21. Isocytosine
    
    or 2 aminouracil is a pyrimidine base that is an isomer of cytosine . It is used in combination ..
    
    
    
    
22. Antileukemic drug
    
    Arsenic trioxide Asparaginase Cladribine Clofarabine Cyclophosphamide Cytosine arabinoside Dasatinib ..
    
    
    
    
23. HELP assay
    
    by L igation mediated Polymerase chain reaction P CR . To study cytosine methylation throughout ... mediated PCR. As Hpa II only digests 5 C CG G 3 sites when the cytosine in the central CG dinucleotide ..
    
    
    
    
24. TRNA (cytosine-5-)-methyltransferase
    
    lowercase In enzymology , a tRNA cytosine 5 methyltransferase EC number 2.1.1.29 is an enzyme that catalysis ... chemistry products are S adenosylhomocysteine and tRNA containing 5 methyl cytosine . This enzyme ..
    
    
    
    
25. Copying
    
    , in DNA replication, an occurrence of guanine in a DNA sequence can be copied because only cytosine ... by attaching another guanine base to the cytosine again. In order to prevent accidental reading of the wrong ..
    
    
    
    

Articles 1 - 25 of 246          Next

Search   in   Tutorials Encyclopedia Dictionary Directory

Search for cytosine in Tutorials

Search for cytosine in Encyclopedia

Search for cytosine in Dictionary

Search for cytosine in Open Directory

Search for cytosine in Store

Search for cytosine in PriceGig

Help build the largest human-edited directory on the web. Submit a Site - Open Directory Project - Become an Editor