Search: in
cytosine
cytosine Encyclopedia
  Tutorials     Encyclopedia     Dictionary     Directory  
Encyclopedia results for cytosine
cytosine Email this to a friend      cytosine

cytosine

Encyclopedia results for cytosine

  1. Cytosine
    Chembox new ImageFile Cytosine chemical structure.png ImageSize 120px IUPACName 4 amino 1H pyrimidine ... Cytosine Section2 Chembox Properties Formula C sub 4 sub H sub 5 sub N sub 3 sub O MolarMass 111.300 ..


  2. Cytosine deaminase
    In enzymology , a cytosine deaminase EC number 3.5.4.1 is an enzyme that catalysis catalyzes the chemical reaction cytosine H sub 2 sub O math rightleftharpoons math uracil NH sub 3 sub Thus, the two substrate ..


  3. Methylase
    cytosine cytosine residues and adenine adenine residues in DNA . See also Demethylase transferase ..


  4. Pyrimidinones
    Image Pyrimidine chemical structure.png thumb Pyrimidine Image Cytosine chemical structure.png thumb Cytosine Image Metharbital.png thumb Metharbital Pyrimidinones are derivatives of pyrimidine which have ..


  5. CpG site
    Image Cytosine chemical structure.png thumb right 100px Cytosine Image Phosphate.png thumb right 125px Phosphate Image Guanine chemical structure.png thumb Guanine CpG sites are regions of DNA where a cytosine ..


  6. Deamination
    in DNA Cytosine Image DesaminierungCtoU.png 250px right Spontaneous deamination is the hydrolysis reaction of cytosine into uracil , releasing ammonia in the process. This can occur in vitro through ..


  7. RasiRNA
    methylating the cytosine nucleotides in DNA, which indicates to the cell to package the DNA ..


  8. Guanine
    FlashPt Non flammable. Section8 Chembox Related OtherAnions OtherCations OtherCpds Cytosine Adenine ... , the others being adenine , cytosine , thymine , and uracil . With the formula C sub 5 sub H sub 5 ..


  9. Pyrimidine
    other forms of diazine . Nucleotides three nucleobase s found in nucleic acid s, namely cytosine , thymine , and uracil , are pyrimidine derivatives Image Cytosine chemical structure.png 101px Chemical ..


  10. Copying
    , in DNA replication, an occurrence of guanine in a DNA sequence can be copied because only cytosine ... by attaching another guanine base to the cytosine again. In order to prevent accidental reading of the wrong ..


  11. List of Y-DNA single nucleotide polymorphisms
    M242 Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine ... 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct M268 M285 Guanine G to Cytosine C 70 287 ttatcctgagccgttgtccctg ..


  12. Transition (genetics)
    pyrimidine nucleotide Cytosine C Thymine T . Approximately two out of every three single nucleotide ... unmethylated cytosine , due to spontaneous deamination . Fact taken from 5 Methylcytosine and deamination ..


  13. Ribonucleotide
    A ribonucleotide is a nucleotide in which a purine or pyrimidine base is linked to a ribose molecule . The base may be adenine A , guanine G , cytosine C , or uracil U . Note that thymine T , which is ...


  14. GC-content
    s. GC content or guanine cytosine content , in molecular biology, is the percentage of nitrogenous bases on a DNA molecule which are either guanine or cytosine from a possibility of four different ..


  15. ACGT
    Unreferenced date February 2007 ACGT stands for the four nucleic acid bases that make up DNA . The A stands for Adenine and pairs with the T, which stands for Thymine . The C stands for Cytosine and p ...


  16. High-GC content bacteria
    High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria   ref NCBI Taxonomy ..


  17. Nitrogenous base
    , triethylamine , pyridine , and the nucleobase s adenine , guanine , thymine , cytosine , and uracil ..


  18. Hyper-IgM syndrome type 5
    cytosine to uracil. In both type 2 and type 5 hyper IgM syndromes, the patients are profoundly ..


  19. Oxidative deamination
    Oxidative deamination is a form of deamination that generates oxoacid s in the liver . The presence of nitrous acid can cause Transition genetics transition mutations , by converting cytosine to uraci ...


  20. Isocytosine
    or 2 aminouracil is a pyrimidine base that is an isomer of cytosine . It is used in combination ..


  21. Nucleoside
    87px Chemical structure of deoxyuridine br Deoxyuridine br dU align center valign Image Cytosine chemical structure.png 51px Chemical structure of cytosine br Cytosine br Image C chemical structure.png ..


  22. Methylation
    . DNA methylation in vertebrates typically occurs at CpG site s cytosine phosphate guanine sites that is, where a cytosine is directly followed by a guanine in the DNA sequence this methylation results ..


  23. 5-Methylcytosine
    Autoignition 5 Methylcytosine is a methylation methylated form of cytosine in which a methyl group ... of cytosine forms uracil, which is recognized and removed by DNA repair enzymes, deamination of 5 ..


  24. Base excision repair
    â the first removes oxoG that is bound to cytosine, repairing the actual damaged base, whereas ... recognizes a thymine to guanine pairing, a common occurrence due to the deamination of 5 methyl cytosine ..


  25. HELP assay
    by L igation mediated Polymerase chain reaction P CR . To study cytosine methylation throughout ... the cytosine in the central CG dinucleotide is unmethylated, the Hpa II representation is enriched ..



Articles 1 - 25 of 112          Next


Search   in  

Related Links in cytosine

Search for cytosine in Tutorials
Search for cytosine in Encyclopedia
Search for cytosine in Dictionary
Search for cytosine in Open Directory
Search for cytosine in Store
Search for cytosine in PriceGig



Help build the largest human-edited directory on the web.
Submit a Site - Open Directory Project - Become an Editor
Advertisement

Advertisement



cytosine
cytosine top cytosine

Home - Add TutorGig to Your Site - Disclaimer

©2008-2009 TutorGig.com. All Rights Reserved. Privacy Statement