Encyclopedia results for adenine

1. Adenine
   For the programming language Adenine Adenine programming language NatOrganicBox image Image Adenine chemical structure.png 116px Image Adenine 3d.png 150px name 9H purin 6 amine synonyms 6 aminopurine ..
   
   
   
2. Adenine deaminase
   In enzymology , an adenine deaminase EC number 3.5.4.2 is an enzyme that catalysis catalyzes the chemical reaction adenine H sub 2 sub O math rightleftharpoons math hypoxanthine NH sub 3 sub Thus, the two ..
   
   
   
3. Adenine phosphoribosyltransferase
   Template PBB Controls to Stop updates. GNF Protein box image Adenine phosphoribosyltransferase 1ZN7.png image source Ribbon diagram of a human APRT dimer , in complex with PRPP, adenine and ribose 5 ..
   
   
   
4. Adenine (programming language)
   Adenine , named after the nucleic acid adenine , is a script language, which is developed in the context ... Telegraph and Telephone NTT . A substantial characteristic of adenine is that this language possesses ..
   
   
   
5. Adenine nucleotide translocator
   protein Name solute carrier family 25 mitochondrial carrier adenine nucleotide translocator , member ... protein Name solute carrier family 25 mitochondrial carrier adenine nucleotide translocator , member ..
   
   
   
6. Adenine phosphoribosyltransferase deficiency
   MedlinePlus eMedicineSubj eMedicineTopic MeshName MeshNumber Adenine phosphoribosyltransferase deficiency ... thumb left PAGENAME has an autosomal recessive pattern of inheritance. See also Adenine phosphoribosyltransferase ..
   
   
   
7. Nicotinamide adenine dinucleotide
   NFPA H 1 NFPA F 1 NFPA R 0 RTECS UU3450000 FlashPt Autoignition Nicotinamide adenine dinucleotide ..
   
   
   
8. Nicotinamide adenine dinucleotide phosphate
   Section3 Chembox Hazards Solubility MainHazards FlashPt Autoignition Nicotinamide adenine dinucleotide ..
   
   
   
9. Nicotinic acid adenine dinucleotide phosphate
   acid adenine dinucleotide phosphate popularly known as NAADP sup sup is a nucleotide very similar ..
   
   
   
10. Methylase
    cytosine cytosine residues and adenine adenine residues in DNA . See also Demethylase transferase ..
    
    
    
11. List of Y-DNA single nucleotide polymorphisms
    Position Forward 5â â 3â Reverse 5â â 3â M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag ... M179 M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg ..
    
    
    
12. Pentosyltransferases
    Pentosyltransferases are a type of glycosyltransferase that catalyze the transfer of a pentose . Examples include adenine phosphoribosyltransferase hypoxanthine guanine phosphoribosyltransferase pertu ...
    
    
    
13. Gelonin
    glycosidase activity on the 28S rRNA unit of eukaryotic ribosomes by cleaving out adenine at the 4324 ..
    
    
    
14. Tetraloop
    adenine base pair where the guanine is 5 to the helix and the adenine is 3 to the helix. References ..
    
    
    
15. Mannuronate reductase
    substrate biochemistry substrates of this enzyme are D mannonate , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 4 product ..
    
    
    
16. 21-hydroxysteroid dehydrogenase (NADP+)
    and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 3 product chemistry products are pregnan 21 al , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup ..
    
    
    
17. Rubredoxin-NAD(P)+ reductase
    adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 4 product chemistry products are oxidized rubredoxin , nicotinamide adenine dinucleotide ..
    
    
    
18. NAD(P)H dehydrogenase (quinone)
    The 4 substrate biochemistry substrates of this enzyme are nicotinamide adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , hydrogen ion H sup sup , and quinone , whereas ..
    
    
    
19. NADPH-hemoprotein reductase
    n reduced hemoprotein The 3 substrate biochemistry substrates of this enzyme are nicotinamide adenine ... two product chemistry products are nicotinamide adenine dinucleotide phosphate NADP sup sup and reduced ..
    
    
    
20. ATP-dependent NAD(P)H-hydrate dehydratase
    catalyzes the chemical reaction ATP 6S 6 beta hydroxy 1,4,5,6 tetrahydronicotinamide adenine ... of this enzyme are adenosine triphosphate ATP , 6S 6 beta hydroxy 1,4,5,6 tetrahydronicotinamide adenine ..
    
    
    
21. FAD diphosphatase
    include FAD pyrophosphatase , riboflavin adenine dinucleotide pyrophosphatase , flavin adenine dinucleotide pyrophosphatase , riboflavine adenine dinucleotide pyrophosphatase , and flavine adenine dinucleotide ..
    
    
    
22. L-glycol dehydrogenase
    H H sup sup The 3 substrate biochemistry substrates of this enzyme are L glycol , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas ..
    
    
    
23. Sorbose 5-dehydrogenase (NADP+)
    adenine dinucleotide phosphate NADP sup sup , whereas its 3 product chemistry products are 5 dehydro D fructose , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup ..
    
    
    
24. Glycerol-3-phosphate dehydrogenase (NAD(P)+)
    3 phosphate , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide ... adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ..
    
    
    
25. 3-(imidazol-5-yl)lactate dehydrogenase
    imidazol 5 yl lactate , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide ... , nicotinamide adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ..