Encyclopedia results for adenine

1. Adenine
   
   For the programming language Adenine Adenine programming language chembox ImageFile1 Adenine chemical structure.png ImageSize1 150px ImageFileL2 Adenine 3D balls.png ImageSizeL2 100px ImageFileR2 Adenine ..
   
   
   
   
2. Adenine deaminase
   
   In enzymology , an adenine deaminase EC number 3.5.4.2 is an enzyme that catalysis catalyzes the chemical reaction adenine H sub 2 sub O math rightleftharpoons math hypoxanthine NH sub 3 sub Thus, the two ..
   
   
   
   
3. Adenine phosphoribosyltransferase
   
   PBB geneid 353 Adenine phosphoribosyltransferase , also known as APRT , is a human gene . ref name entrez cite web title Entrez Gene APRT adenine phosphoribosyltransferase url http www.ncbi.nlm.nih.gov ..
   
   
   
   
4. Adenine (programming language)
   
   Adenine , named after the nucleic acid adenine , is a script language, which is developed in the context ... Telegraph and Telephone NTT . A substantial characteristic of adenine is that this language possesses ..
   
   
   
   
5. Adenine nucleotide translocator
   
   protein Name solute carrier family 25 mitochondrial carrier adenine nucleotide translocator , member ... protein Name solute carrier family 25 mitochondrial carrier adenine nucleotide translocator , member ..
   
   
   
   
6. Adenine phosphoribosyltransferase deficiency
   
   eMedicineTopic MeshName MeshNumber Adenine phosphoribosyltransferase deficiency also called 2,8 dihydroxyadenine ... cite journal pmid 8976113 year 1996 month Dec author Kamatani, N title Adenine phosphoribosyltransferase ..
   
   
   
   
7. Nicotinamide adenine dinucleotide phosphate
   
   Section3 Chembox Hazards Solubility MainHazards FlashPt Autoignition Nicotinamide adenine dinucleotide ... center Ball and stick model of NADPH center gallery center See also Nicotinamide adenine dinucleotide ..
   
   
   
   
8. Nicotinamide adenine dinucleotide
   
   NFPA H 1 NFPA F 1 NFPA R 0 RTECS UU3450000 FlashPt Autoignition Nicotinamide adenine dinucleotide ... converted into nicotinamide adenine dinucleotide phosphate NADP sup sup the chemistry of this related ..
   
   
   
   
9. Nicotinic acid adenine dinucleotide phosphate
   
   acid adenine dinucleotide phosphate popularly known as NAADP sup sup is a nucleotide very similar ..
   
   
   
   
10. Phosphoribosyltransferase
    
    Phosphoribosyltransferase may refer to Adenine phosphoribosyltransferase Hypoxanthine guanine phosphoribosyltransferase Orotidine 5 phosphate decarboxylase Uracil phosphoribosyltransferase disambig ..
    
    
    
    
11. Methylase
    
    cytosine cytosine residues and adenine adenine residues in DNA . See also Demethylase transferase ..
    
    
    
    
12. Pentosyltransferases
    
    Pentosyltransferases are a type of glycosyltransferase that catalyze the transfer of a pentose . Examples include adenine phosphoribosyltransferase hypoxanthine guanine phosphoribosyltransferase pertu ...
    
    
    
    
13. Gelonin
    
    glycosidase activity on the 28S rRNA unit of eukaryotic ribosomes by cleaving out adenine at the 4324 ..
    
    
    
    
14. List of Y-DNA single nucleotide polymorphisms
    
    Position Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag ... M201 M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg ..
    
    
    
    
15. Tetraloop
    
    has a guanine adenine base pair where the guanine is 5 to the helix and the adenine is 3 to the helix ..
    
    
    
    
16. FAD
    
    Chembox new ImageFile flavin adenine dinucleotide.png ImageSize IUPACName OtherNames Section1 Chembox Identifiers CASNo 146 14 5 PubChem 703 SMILES MeSHName Flavin Adenine Dinucleotide Section2 Chembox ..
    
    
    
    
17. Mannuronate reductase
    
    substrate biochemistry substrates of this enzyme are D mannonate , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 4 product ..
    
    
    
    
18. 21-hydroxysteroid dehydrogenase (NADP+)
    
    and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 3 product chemistry products are pregnan 21 al , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup ..
    
    
    
    
19. Rubredoxin-NAD(P)+ reductase
    
    adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 4 product chemistry products are oxidized rubredoxin , nicotinamide adenine dinucleotide ..
    
    
    
    
20. FAD diphosphatase
    
    include FAD pyrophosphatase , riboflavin adenine dinucleotide pyrophosphatase , flavin adenine dinucleotide pyrophosphatase , riboflavine adenine dinucleotide pyrophosphatase , and flavine adenine dinucleotide ..
    
    
    
    
21. L-glycol dehydrogenase
    
    H H sup sup The 3 substrate biochemistry substrates of this enzyme are L glycol , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas ..
    
    
    
    
22. Sorbose 5-dehydrogenase (NADP+)
    
    adenine dinucleotide phosphate NADP sup sup , whereas its 3 product chemistry products are 5 dehydro D fructose , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ion H sup sup ..
    
    
    
    
23. 3-(imidazol-5-yl)lactate dehydrogenase
    
    imidazol 5 yl lactate , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide ... , nicotinamide adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ..
    
    
    
    
24. L-aminoadipate-semialdehyde dehydrogenase
    
    are L 2 aminoadipate 6 semialdehyde , nicotinamide adenine dinucleotide NAD sup sup , nicotinamide adenine dinucleotide phosphate NADP sup sup , and water H sub 2 sub O , whereas its 4 product ..
    
    
    
    
25. ATP-dependent NAD(P)H-hydrate dehydratase
    
    catalyzes the chemical reaction ATP 6S 6 beta hydroxy 1,4,5,6 tetrahydronicotinamide adenine ... of this enzyme are adenosine triphosphate ATP , 6S 6 beta hydroxy 1,4,5,6 tetrahydronicotinamide adenine ..
    
    
    
    

Articles 1 - 25 of 1042          Next

Search   in   Tutorials Encyclopedia Dictionary Directory

Search for adenine in Tutorials

Search for adenine in Encyclopedia

Search for adenine in Dictionary

Search for adenine in Open Directory

Search for adenine in Store

Search for adenine in PriceGig

Help build the largest human-edited directory on the web. Submit a Site - Open Directory Project - Become an Editor