Encyclopedia results for Thymine

1. Thymine
   
   ImageFile1 Thymine chemical structure.png ImageSize1 150px ImageFileL2 Thymine 3D balls.png ImageSizeL2 100px ImageFileR2 Thymine 3D vdW.png ImageSizeR2 100px ImageFile ImageSize IUPACName 5 Methylpyrimidine ..
   
   
   
   
2. Thymine dioxygenase
   
   enzyme Name thymine dioxygenase EC number 1.14.11.6 CAS number 37256 67 0 IUBMB EC number 1 14 11 6 GO code 0050341 image width caption In enzymology , a thymine dioxygenase EC number 1.14.11.6 is an enzyme ..
   
   
   
   
3. Thymine dimer
   
   thumb right 300px DNA Lesion Thymine Dimer A thymine dimer is the covalent bonding of two adjacent thymine residues within a DNA molecule, often catalyzed by ultraviolet radiation or chemical ..
   
   
   
   
4. Thymine-DNA glycosylase
   
   PBB geneid 6996 G T mismatch specific thymine DNA glycosylase is an enzyme that in humans is encoded ... specific thymine DNA glycosylase journal J Biol Chem volume 271 issue 22 pages 12767 74 year 1996 month ..
   
   
   
   
5. File:Thymine Dimer.jpg
   
   Licensing PD self date December 2006 ..
   
   
   
   
6. Nitrogenous base
   
   , the nucleobase s building blocks of DNA and RNA adenine , guanine , thymine , cytosine , and uracil . Adenine and thymine guanine and cytosine are complementary to each other. Adenine pairs only with thymine ..
   
   
   
   
7. File:DiampurineT DNA base pair.svg
   
   Summary Information Description Diaminopurine thymine pair Source self made Date . Location . Author User Squidonius Squidonius User talk Squidonius talk other versions Licensing PD self date March 2008 ..
   
   
   
   
8. File:XA-T DNA base pair.svg
   
   Summary Information Description extended adenine thymine pair Source self made Date . Location . Author User Squidonius Squidonius User talk Squidonius talk other versions Licensing PD self date April ..
   
   
   
   
9. ACGT
   
   for Adenine and pairs with the T, which stands for Thymine . The C stands for Cytosine and pairs ... for the four amino acids that make up RNA . RNA pairs up the same as DNA, except that Thymine ..
   
   
   
   
10. Repeat induced point-mutation
    
    A Thymine T mutations. It is associated with DNA methylation . Molecular cell biology stub ..
    
    
    
    
11. Pyrimidinedione
    
    ,3 H dione Image Uracil.svg Pyrimidine biosynthesis Thymine 5 Methylpyrimidine 2,4 1 H ,3 H dione File Thymine chemical structure.png 150px Pyrimidine biosynthesis 5,6 Diaminopyrimidine 2,4 1 H ,3 H dione ..
    
    
    
    
12. List of Y-DNA single-nucleotide polymorphisms
    
    C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G 148 287 ttatcctgagccgttgtccctg ..
    
    
    
    
13. High-GC content bacteria
    
    High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria   ref NCBI ...
    
    
    
    
14. TDG
    
    Thymine DNA glycosylase , an enzyme disambig Long comment to avoid being listed on short pages de TDG ..
    
    
    
    
15. Spore photoproduct lyase
    
    bacterial spores. The enzyme is radical SAM dependent. Through a series of radical reactions the Thymine ... thymine rings. ref cite journal author Susan C. Wang and Perry A. Frey title S adenosylmethionine ..
    
    
    
    
16. Deamination
    
    . 5 methylcytosine Spontaneous deamination of 5 methylcytosine results in thymine and ammonia. This is the most ... mechanisms do not recognize thymine as erroneous as opposed to uracil , and, unless it affects ..
    
    
    
    
17. Ribonucleotide
    
    A ribonucleotide is a nucleotide in which a purine or pyrimidine base is linked to a ribose molecule . The base may be adenine A , guanine G , cytosine C , or uracil U . Note that thymine T , which is ...
    
    
    
    
18. Dihydropyrimidine dehydrogenase
    
    of uracil and thymine . It is also involved in the degradation of the chemotherapeutic drugs ..
    
    
    
    
19. 3-Aminoisobutyric acid
    
    3 Aminoisobutyric acid is a product formed by the catabolism of thymine . Nucleotide metabolism ..
    
    
    
    
20. Dihydrothymine
    
    FlashPt Autoignition Dihydrothymine is an intermediate in the metabolism of thymine . Nucleotide ..
    
    
    
    
21. QMC@Home
    
    6b 2 aminopyridine 6 2 pyridoxine 2 aminopyridine 7a Adenine 7b Thymine 7 Adenine thymine WC 8a Methane ... Pyrazine 12 Pyrazine dimer 13 Uracil dimer 14a Indole 14 Indole benzene 15 Adenine thymine stack 16b ..
    
    
    
    
22. Thymidine
    
    can also be labelled deoxyribosylthymine , and thymine deoxyriboside is a chemical Chemical ... and Thymine by Erwinia carotovora AJ 2992 author Makoto Ishii, Hideyuki Shirae, Kenzo Yokozeko ..
    
    
    
    
23. Genetics glossary
    
    span Adenine One of the four nucleotide bases in DNA DNA or RNA RNA pairs with thymine thymine ... reaction s that occur inside the cell biology cell . T span id thymine span Thymine One of the four ..
    
    
    
    
24. Pyrimidine dimers
    
    mergefrom Thymine dimer discuss Talk Pyrimidine dimers Proposed merger date May 2009 Pyrimidine dimers ... dimers form from pairs of thymine bases or pairs of cytosine bases in via photochemical reaction ..
    
    
    
    
25. Pribnow box
    
    The Pribnow box also known as the Pribnow Schaller box is the sequence TATAAT of six nucleotide s thymine adenine thymine etc. that is an essential part of a promoter site on DNA for Transcription genetics ..
    
    
    
    

Articles 1 - 25 of 246          Next

Search   in   Tutorials Encyclopedia Dictionary Directory

Search for Thymine in Tutorials

Search for Thymine in Encyclopedia

Search for Thymine in Dictionary

Search for Thymine in Open Directory

Search for Thymine in Store

Search for Thymine in PriceGig

Help build the largest human-edited directory on the web. Submit a Site - Open Directory Project - Become an Editor