Search: in
Thymine
Thymine Encyclopedia
  Tutorials     Encyclopedia     Dictionary     Directory  
Encyclopedia results for Thymine
Thymine Email this to a friend      Thymine

Thymine

Encyclopedia results for Thymine

  1. Thymine
    CC1 CNC O NC1 O MeSHName Thymine Section2 Chembox Properties Formula C sub 5 sub H sub 6 sub N ... Chembox Hazards Solubility MainHazards FlashPt Autoignition Thymine is one of the four bases ..


  2. Thymine dimer
    Image TDdimer.png right thumb A thymine dimer is the covalent bonding of two adjacent thymine residues .... Unrepaired or mis repaired thymine dimers and the resultant mutations can contribute to the development ..


  3. Thymine dioxygenase
    In enzymology , a thymine dioxygenase EC number 1.14.11.6 is an enzyme that catalysis catalyzes the chemical reaction thymine 2 oxoglutarate O sub 2 sub math rightleftharpoons math 5 hydroxymethyluracil ..


  4. Thymine-DNA glycosylase
    Protein Data Bank PDB rendering based on 1wyw. PDB PDB2 1wyw , PDB2 2d07 Name Thymine DNA glycosylase ... end Mm Uniprot Thymine DNA glycosylase , also known as TDG , is a human gene . ref name entrez cite ..


  5. TDG
    TDG may refer to TDG , a singer producer founder of WHOL E MUSIC Three Days Grace , a rock band Thymine DNA glycosylase , an enyzme disambig Long comment to avoid being listed on short pages ..


  6. ACGT
    for Adenine and pairs with the T, which stands for Thymine . The C stands for Cytosine and pairs ... stands for the four amino acids that make up RNA . RNA pairs up the same as DNA , except that Thymine ..


  7. List of Y-DNA single nucleotide polymorphisms
    M242 Cytosine C to Thymine T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc M253 Cytosine C to Thymine T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt M258 M267 Thymine T to Guanine G ..


  8. Direct DNA damage
    left . One of the possible reactions from the excited state is the formation of a thymine thymine ... thymine base pairs next to each other in genetic sequences to bond together into thymine dimers ..


  9. Pyrimidine
    other forms of diazine . Nucleotides three nucleobase s found in nucleic acid s, namely cytosine , thymine ... structure of cytosine Image Thymine chemical structure.png 127px Chemical structure of thymine Image ..


  10. Uracil
    NFPA F 1 NFPA R FlashPt non flammable Section8 Chembox Related OtherCpds Thymine Uracil is a pyrimidine ... in RNA , it base pair s with adenine and is replaced by thymine in DNA . Methylation of uracil ..


  11. Thymidine
    Thymidine more precisely called deoxythymidine can also be labelled deoxyribosylthymine , and thymine ... composition, deoxythymidine is deoxyribose a pentose sugar joined to the pyrimidine base thymine ..


  12. Ribonucleotide
    A ribonucleotide is a nucleotide in which a purine or pyrimidine base is linked to a ribose molecule . The base may be adenine A , guanine G , cytosine C , or uracil U . Note that thymine T , which is ...


  13. Dihydropyrimidine dehydrogenase
    Dihydropyrimidine dehydrogenase DPD is an enzyme that is involved in pyrimidine degradation. It is the initial and rate limiting step in pyrimidine catabolism. It catalyzes the reduction of uracil and ...


  14. Recognition sequence
    G T indicates that the domain will bind a guanine or thymine at this position. The Restriction endonuclease ..


  15. High-GC content bacteria
    High GC content bacteria are Gram positive bacteria with a high number of guanine and cytosine bases as compared to adenine and thymine . These bacteria are of the class Actinobacteria   ref NCBI ...


  16. Spore photoproduct lyase
    bacterial spores. The enzyme is radical SAM dependent. Through a series of radical reactions the Thymine ... thymine rings. ref cite journal author Susan C. Wang and Perry A. Frey title S adenosylmethionine ..


  17. Nitrogenous base
    , triethylamine , pyridine , and the nucleobase s adenine , guanine , thymine , cytosine , and uracil ..


  18. Bisbenzimide
    Adenine Thymine base pairs. References Sigma Aldrich Product Information Page ..


  19. Guanine
    Thymine Uracil Guanine is one of the five main nucleobase s found in the nucleic acid s DNA and RNA , the others being adenine , cytosine , thymine , and uracil . With the formula C sub 5 sub H sub 5 ..


  20. Nucleobase
    base pairs . These include cytosine , guanine , adenine , thymine DNA and uracil RNA . These are abbreviated ... RNA bases , respectively. Uracil replaces thymine in RNA. These two bases are identical except that uracil ..


  21. Nucleoside
    Thymine chemical structure.png 63px Chemical structure of thymine br Thymine br Image T chemical ..


  22. Pribnow box
    The Pribnow box also known as the Pribnow Schaller box is the sequence TATAAT of six nucleotide s thymine adenine thymine etc. that is an essential part of a promoter site on DNA for Transcription genetics ..


  23. QMC@Home
    6 2 pyridoxine 2 aminopyridine 7a Adenine 7b Thymine 7 Adenine thymine WC 8a Methane 8 Methane ... dimer 13 Uracil dimer 14a Indole 14 Indole benzene 15 Adenine thymine stack 16b Ethine 16 Ethene ..


  24. Ada (protein)
    6 sup alkyl guanine or thymine O sup 4 sup alkyl thymine and to the oxygen of the phosphodiester backbone ... compared to either O sup 4 sup thymine and alkylated phosphotriesters. Ada enzyme has two active sites ..


  25. Nucleic acid nomenclature
    an adenine nucleotide is abbreviated as A , guanine as G , cytosine as C , thymine as T , and in RNA ..



Articles 1 - 25 of 107          Next


Search   in  
Search for Thymine in Tutorials
Search for Thymine in Encyclopedia
Search for Thymine in Dictionary
Search for Thymine in Open Directory
Search for Thymine in Store
Search for Thymine in PriceGig



Help build the largest human-edited directory on the web.
Submit a Site - Open Directory Project - Become an Editor
Advertisement

Advertisement



Thymine
Thymine top Thymine

Home - Add TutorGig to Your Site - Disclaimer

©2008-2009 TutorGig.com. All Rights Reserved. Privacy Statement