RecombinantDNA rDNA is a form of artificial DNA that is created by combining two or more Nucleic acid ... isbn0 7167 8724 5 A recombinant protein is a protein that is produced from recombinantDNA. ref ..., the use of recombinantDNA provides the initial cell from which the host organism is then expected ... due to the use of viral vector s in medicine that contain recombinantDNA inserted into a structure ... of cells with the recombinantDNA present within them. The use of plasmids is also key within ... of transporting and passing on genes in recombinantDNA through viral reproduction throughout an organism ... foreign DNA into the genomes of many plants. Other methods of introducing or creating recombinant ... blunt ends via the enzyme, T4 Ligase. When recombinantDNA is then further altered or changed to host ... Nathan P. Kaplan, Nathan P. Colowick, Ray Wu title RecombinantDNA, Volume 68 Volume 68 Recombinant ... proteins that are created from recombinantDNA and used as medication s. Some ... used as medication, only has recombinantDNA as a source, such as with erythropoietin . History The recombinant ..., creating a Transgenic Bacteria transgenic bacterium . Exploitation of recombinantDNA technology ... in the application of recombinantDNA technology occurred in 1977 when Herbert Boyer produced ... colony of the E. coli bacteria. It was the first medicine made via recombinantDNA technology ... cgi content abstract 219 4585 632 Human insulin from recombinantDNA technology Johnson ... DNA List of recombinant proteins The Non GMO Project Recombinant virus Vector DNA Notes reflist ... first2 O. N. title Methods in Enzymology Volume 68 RecombinantDNA publisher Academic Press year ... http www.unh.edu ehs pdf Recombinant DNA.pdf Fact Sheet Describing RecombinantDNA and Elements Utilizing RecombinantDNA Such as Plasmids and Viral Vectors, and the Application of RecombinantDNA ... RecombinantDNA research at UCSF and commercial application at Genentech Herbert W. Boyer, Living history ... more details
File Paul Berg in 1980.jpg thumb right Paul Berg , a leading researcher in the field of recombinantDNA ... Sanger . The Asilomar Conference on RecombinantDNA was an influential academic conference conference organized by Paul Berg ref First recombinantDNA. The Human Genome Project. http www.genome.gov ... Statement of the Asilomar Conference on RecombinantDNA Molecules . Proc. Nat. Acad. Sci. Vol. 72, No. 6 ... to ensure the safety of recombinantDNA technology. The conference also placed scientific research ... F. Singer. The recombinantDNA controversy Twenty years later . Proc. Natl. Acad. Sci. Vol 92 ... experiments using recombinantDNA technology, which entailed combining DNAs from different organisms ... recombinantDNA technology RecombinantDNA technology arose as a result of advances in biology ... capacities to manipulate DNA. ref Susan Wright. RecombinantDNA Technology and Its Social Transformation ... recombinantDNA technology was a biochemist at Stanford by the name of Paul Berg. ref Paul Berg and Maxine F. Singer. The recombinantDNA controversy Twenty years later . Proc. Natl. Acad. Sci ... technology. This committee, called the Committee on RecombinantDNA molecules of the National Academy ... Established principles The Asilomar Conference on RecombinantDNA took place at the Asilomar Conference ... of the conference was to address the biohazards presented by recombinantDNA technology. During the conference ... Statement of the Asilomar Conference on RecombinantDNA Molecules . Proc. Nat. Acad. Sci. Vol ... to limit the spread of recombinantDNA. Such biological barriers included fastidious bacterial hosts ... that the recombinantDNA could not either alter appreciably the ecological behavior of the recipient ... that involved the construction and propagation of recombinantDNA molecules using DNA from ... the creation and propagation of recombinantDNA molecules from DNAs of species that ordinarily did ... segments of DNA using recombinantDNA technology from warm blooded vertebrates genomes were to be performed ... more details
Enzo Paoletti and Dennis Panicali at the New York State department of Health, devised a Strategy to produce recombinant DNA vaccines by using genetic engineering techniques. They were able to transform ordinary smallpox vaccine into vaccines that may be able to prevent other diseases. What Paoletti and his colleague, Virologist Dennis Panicali, set out to do was to alter the DNA of cowpox virus by inserting a gene from another virus namely herpes, hepatitis B or influenza . These efforts resulted, amongst others in the development of a commercial Hepatitis B vaccine which is now widely used. ref References ref http www.time.com time magazine article 0,9171,921366,00.html Time Magazine article on Paoletti s work http www.thefreelibrary.com A vaccine for all seasons 3B genetic engineering is remodeling the... a03815488 Article on Paoletti s work http www.thefreelibrary.com A vaccine for all seasons 3B genetic engineering is remodeling the... a03815488 Paoletti s vaccine for herpes Category Italian inventions references Paoletti, Enzo, Bernard R. Lipinskas, Carol Samsonoff, Susan Mercer, and Dennis Panicali 1984 Construction of Live Vaccines Using Genetically Engineered Poxviruses Biological Activity of Vaccinia Virus Recombinants Expressing the Hepatitis B Virus Surface Antigen and the Herpes Simplex Virus Glycoprotein D Proc. Natl. Acad. Sci. USA 81 193 197 Panicali, Dennis, Stephen W. Davis, Randall L. Weinberg, Enzo Paoletti 1983 Construction of Live Vaccines by Using Genetically Engineered Poxviruses Biological Activity of Recombinant Vaccinia Virus Expressing Influenza Virus Hemagglutinin Proc. Natl. Acad. Sci. USA 80 5364 5368 US Patent 4722848 Method for immunizing animals with synthetically modified vaccinia virus ... more details
Recombinant may refer to A recombinant organism an organism that contains a different combination of Allele alleles from either of its parents. RecombinantDNA a form of artificial DNARecombinant virus a virus formed by recombining genetic material VRLA , a valve regulated lead acid VRLA battery that is also referred to as a recombinant battery InSoc Recombinant , an album by synthpop band Information Society See also Recombination disambiguation disambig de Rekombinant ... more details
A recombinant virus is a virus produced by recombining pieces of DNA using recombinantDNA technology. This may be used to produce vaccine viral vaccine s or gene therapy vectors. It is also used to refer to naturally occurring recombination between virus genomes in a cell infected by more than one virus strain. This occurs either by homologous crossing over of the nucleic acid strands or by reassortment of genomic segments. Both these and mutation within the virus have been suggested as ways in which influenza and other viruses evolve. Reassortment is most important for pandemic influenza viruses. See also Reassortment Mutation References http www.cdc.gov ncidod eid vol10no4 03 0396.htm Recombination Resulting in Virulence Shift in Avian Influenza Outbreak, Chile. Suarez et al 2009 http mbe.oxfordjournals.org cgi content abstract 26 1 177?maxtoshow &HITS 1&hits 1&RESULTFORMAT &andorexacttitle phrase&titleabstract H5N1&andorexacttitleabs and&andorexactfulltext and&searchid 1&usestrictdates yes&resourcetype HWCIT&ct Homologous Recombination as an Evolutionary Force in the Avian Influenza A Virus. He at al 2008 External links http www.pbs.org wgbh amex influenza sfeature drjeffrey8.html Dr. Jeffery Taubenberger on A Recombinant Virus http crisp.cit.nih.gov Thesaurus 00006973.htm Recombinant virus http pathmicro.med.sc.edu mhunt genet.htm Viral Genetics http www.cdc.gov flu avian gen info transmission.htm Transmission of Influenza A Viruses Between Animals and People Virus topics DEFAULTSORT Recombinant Virus Category Virology Category Influenza Category Microbiology ... more details
Infobox Album See Wikipedia WikiProject Albums Name InSoc Recombinant Type Remix Artist Information Society band Information Society Cover Released April 6, 1999 Recorded Genre Synthpop Length Label Cleopatra Records Cleopatra Producer Reviews Last album Don t Be Afraid album Don t Be Afraid br 1997 This album InSoc Recombinant br 1999 Next album strange haircuts cardboard guitars and computer samples br 2001 InSoc Recombinant is a compilation album of the greatest hits by synthpop band Information Society band Information Society , in various remix remixed versions. It includes, as a bonus, a CD ROM with five music videos. Track listing What s on Your Mind Pure Energy CKB Remix Closing In Rosetta Stone band Rosetta Stone Mix Peace & Love, Inc. Biokraft Mix Think Information Society song Think Spahn Ranch band Spahn Ranch Mix What s on Your Mind? Pure Energy Girl Eats Boy Mix Walking Away Le ther Strip Mix Going Going Gone Razed in Black Mix What s on Your Mind? Pure Energy Judson Leach and the Exhibition Mix Empty Astralasia Mix Ending World Electric Hellfire Club Mix On the Outside THC band THC Mix What s on Your Mind? Pure Energy David J Remix The Brazilian release included InSoc s cover of Madonna entertainer Madonna s Express Yourself Madonna song Express Yourself previously released in the compilation Virgin Voices A Tribute To Madonna . http www.insoc.com.br mix recomb.php All the remixes of What s On Your Mind? Pure Energy were previously released on a 12 single the year before. Video listing What s on Your Mind Pure Energy Walking Away Repetition Think Peace & Love, Inc Category Information Society albums Category 1999 remix albums 1990s electronic album stub 1990s compilation album stub ... more details
File DNA Structure Key Labelled.png thumb right 340px The structure of the DNA double helix . The atoms ... ADN animation.gif thumb The structure of part of a DNA double helix Deoxyribonucleic acid IPA en di ksi ra b .nju kle . k s d en us Deoxyribonucleic acid.ogg , or DNA , is a nucleic acid that contains ... organism s with the exception of RNA virus es . The main role of DNA molecule s is the long term storage of information . DNA is often compared to a set of blueprint s, like a recipe or a code, since ... s and RNA molecules. The DNA segments that carry this genetic information are called gene s, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. DNA consists of two long polymers of simple units called nucleotide s, with backbone ... is read by copying stretches of DNA into the related nucleic acid RNA, in a process called transcription genetics transcription . Within cells, DNA is organized into long structures called chromosome s. These chromosomes are duplicated before cells cell division divide , in a process called DNA ... most of their DNA inside the cell nucleus and some of their DNA in organelle s, such as mitochondria ... store their DNA only in the cytoplasm . Within the chromosomes, chromatin proteins such as histone s compact and organize DNA. These compact structures guide the interactions between DNA and other proteins, helping control which parts of the DNA are transcribed. Properties File DNA chemical structure.svg thumb 300px Chemical structure of DNA. Hydrogen bond s shown as dotted lines. DNA is a long polymer ... 57023651 69932405 ref ref name Butler cite book author Butler, John M. year 2001 title Forensic DNA ... by James D. Watson and Francis Crick , the structure of DNA of all species comprises two helical ... solution, the DNA chain measured 22 to 26 ngstr m s wide 2.2 to 2.6 nanometre s , and one ... J, Eden D, Crothers D title The dimensions of DNA in solution journal J Mol Biol volume 152 issue ... more details
Image A DNA orbit animated small.gif right frame The A DNA structure. A DNA is one of the many possible double helical structures of DNA . A DNA is thought to be one of three biologically active double helical structures along with B DNA B and Z DNA . It is a right handed double helix fairly similar to the more common and well known B DNA form, but with a shorter more compact helical structure. It appears likely that it occurs only in dehydrated samples of DNA, such as those used in crystallographic experiments, and possibly is also assumed by DNA RNA hybrid helices and by regions of double stranded RNA. Structure A DNA is fairly similar to B DNA given that it is a right handed double helix with major ... turn. This results in a deepening of the major groove and a shallowing of the minor. Predicting A DNA structure An algorithm for predicting the propensity of a sequence to flip from B DNA to A DNA ... cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages 6464 6468 year ... in the hydration of DNA surfaces can be used to distinguish between sequences that form A and B DNA. From this, a triplet code of A DNA propensities was derived as energetic rules for predicting A DNA formation. This code correctly predicted 90 of A and B DNA sequences in crystals and correlates with A DNA formation in solution. Thus, with our previous studies on Z DNA, we now have a single method to predict the relative stability of sequences in the three standard DNA duplex conformations. ref name Basham1995 cite journal author Basham B, Schroth GP, Ho PS title An A DNA triplet code thermodynamic rules for predicting A and B DNA journal Proc Natl Acad Sci USA volume 92 issue 14 pages ... of the Most Common DNA Forms Image A DNA, B DNA and Z DNA.png right thumb Side view of A , B , and Z DNA. Image B&Z&A DNA formula.jpg thumb right 250px The helix axis of A , B , and Z DNA. class ... more details
Infobox animanga Header name DNA image caption ja kanji D N A ja romaji D En Ei Ts Dokoka de Nakushita Aitsu no Aitsu genre Harem genre Harem , Science fiction Infobox animanga Print type manga author Masakazu Katsura publisher Shueisha publisher other flagicon FRA Editions Tonkam br flagicon GER Carlsen Comics br flagicon MEX Grupo Editorial Vid br flagicon ESP Planeta DeAgostini Comics br flagicon BRA Editora JBC demographic Sh nen manga Sh nen magazine Weekly Sh nen Jump first 1993 last 1994 volumes 5 volume list Infobox animanga Video type tv series director Jun ichi Sakata producer writer music studio Madhouse company Madhouse br Studio Deen network Animax , Nippon Television network other flagicon KOR Animax first 7 October 1994 last 23 December 1994 episodes 12 episode list Infobox animanga Video type ova director Jun ichi Sakata producer writer music studio Madhouse company Madhouse br Studio Deen released 1995 runtime episodes 3 episode list Infobox animanga Footer nihongo DNA D N A D En Ei Ts Dokoka de Nakushita Aitsu no Aitsu is a science ... 100 children that carry the Mega Playboy DNA, causing them and all their descendants to each have 100 ... to deal with. Karin reveals to Junta that she is a DNA Operator . Her job is to make alterations in people s DNA that will change their nature for the greater good of society. She intends to shoot the original Mega Playboy with a DCM DNA Control Medicine bullet that will alter his DNA in order ... DCM bullet. However, each time he transforms, his Mega Playboy DNA stabilizes more and more. nihongo Karin Aoi Aoi Karin anime voices Miina Tominaga Jessica Calvello A sixteen year old DNA ... Never Forget You Manga The DNA manga was published in Japanese magazine Weekly Sh nen Jump 1993 No. 36 ... es ca DNA cs DNA de DNA es DNA fr DNA ko DNA id DNA it DNA ja D N A pt DNA ru DNA fi DNA sv DNA tl DNA zh DNA ... more details
A recombinant inbred strain or recombinant inbred line is an organism with chromosomes that incorporate an essentially permanent set of recombination events between chromosomes inherited from two or more inbred strain s. Families of recombinant inbred strains numbering from 25 to 5000 are often used to map the locations of DNA sequence differences quantitative trait loci that contributed to differences in phenotype in model organisms. Recombinant inbred strains or lines were first developed using ... melanogaster , C. elegans, and rat. History The origins and history of recombinant inbred strains ..., Taylor and recombinant inbred lines. journal Genetics year 2007 volume 176 pages 729 732 pmid 17579238 url http www.genetics.org cgi content full 176 2 729 ref . While the potential utility of recombinant ... quasi Mendelian loci . One of the initial motivations to use recombinant inbred strains was that expensive ... genotyping became much easier and recombinant inbred strains lost this advantage. The main advantage ... research projects in predictive medicine . Use Recombinant inbred strains are now widely ... extensive genetic and phenotype data for each member of a family of recombinant inbred strains under .... Genetics Chromosomes of recombinant inbred strains typically consist of alternating haplotypes ... of a typical mouse recombinant inbred strain made by crossing maternal strain BALB cBy C with paternal strain C57BL 6By B called a CXB recombinant inbred strain, a chromosome will typically incorporate ... of centimorgan or DNA basepair position. The precision with which these recombinations are mapped ... above. Mapping All else being equal, the larger the family of recombinant inbred strains, the greater ... larger families of recombinant inbred strains were generated concurrently by Benjamin Taylor to map Mendelian and other major effect loci. In the 1990s the utility of recombinant inbred strains for mapping ... markers. Between 2005 and 2007, virtually all extant mouse and rat recombinant inbred ... more details
Following is a list of notable proteins that are generated from recombinantDNA . Since human recombinants have replaced the animal version in human therapeutics, the prefix of rh for human recombinant appears less and less in the literature Human recombinants that largely replaced animal or harvested from human types Growth hormone Human growth hormone rHGH Humatrope from Eli Lilly and Company Lilly and Serostim from Serono replaced cadaver harvested human growth hormone Biosynthetic Insulin human insulin BHI Humulin from Eli Lilly and Company Lilly and Novolin from Novo Nordisk among others largely replaced bovine and porcine insulin for human therapy. Some prefer to continue using the animal sourced preparations, as there is some evidence that synthetic insulin varieties are more likely to induce Diabetic hypoglycemia Hypoglycemic unawareness hypoglycemia unawareness . Remaining manufacturers of highly purified animal sourced insulin include the U.K. s Wockhardt Ltd. headquartered in India , Poland s Polfa Tarchomin S.A., Argentina s Laboratorios Beta S.A., and China s Wanbang Biopharma Co. Follicle stimulating hormone FSH as a recombinant gonadotropin preparation replaced Serono s Pergonal which was previously isolated from post menopausal female urine Factor VIII Kogenate from Bayer replaced blood harvested factor VIII Human recombinants with recombination as only source Erythropoietin EPO Epogen from Amgen Granulocyte colony stimulating factor G CSF filgrastim sold as Neupogen from Amgen pegfilgrastim sold as Neulasta alpha glactosidase A Fabrazyme by Genzyme alpha L iduronidase rhIDU laronidase Aldurazyme by BioMarin Pharmaceutical and Genzyme N acetylgalactosamine 4 sulfatase rhASB galsulfase Naglazyme TM by BioMarin Pharmaceutical Dornase alfa , a DNase sold under the trade name Pulmozyme by Genentech Tissue plasminogen activator TPA Activase by Genentech Glucocerebrosidase Ceredase by Genzyme Interferon IF Interferon beta 1a as Avonex from Biogen Idec Rebif ... more details
Orphan date November 2006 Recombinant Human Dragon is an internet based multimedia installation exploring issues of cultural ownership and re use. It is also home to the musical artists Beastmaster Romance and The Earl of Bandwidth . Manifesto excerpts We too often confuse doing an activity with being entertained. We too readily accept passive entertainment as a substitute for active participation in culture, consumption as a substitute for production. We too often convince ourselves to be satisfied with cultural opportunities which ask us to invest nothing other than money. The project of recombinant cultural production asserts the necessity of hybrids, the impossibility of inventing anything completely new. Works of culture always borrow from, build off of, and make reference to past works, whether they like it or not. Originality is a myth that belongs with the epic works of 19th romanticism. Leave it there. You cannot create something from nothing. One needs raw materials. The process of creation requires appropriation. Influences Dadaism Situationist International Situationism External links http recombinanthumandragon.com Recombinant Human Dragon Website Category Artist groups and collectives Artist stub ... more details
Orphan date February 2011 New unreviewed article source ArticleWizard date January 2011 The Recombinant Immunotoxin Collaborative Group RICG is a group of scientists specialising in immunology, biochemistry and molecular biology from the United Kingdom and Italy. The group is working toward the development of genetically engineered immunotoxins made from monoclonal antibody fragments genetically fused to either saporin or Pseudomonas exotoxin PE for the treatment of human hematological malignancies such as leukaemia , lymphoma and multiple myeloma . The RICG was formed in 2005 and originally consisted of Dr Aldo Ceriotti and Dr M. Serena Fabbrini IBBA, CNR, Milan , Professor Marco Colombatti University of Verona , Professor Rodolfo Ippoliti University of L Aquila , Dr Alessandro Pini University of Siena and Drs David Flavell & Sopsamorn Flavell University of Southampton Medical School & Leukaemia Busters . Dr Alessandro Pini left the group in 2007. The RICG was successful in producing a range of recombinant immunotoxins based on the monoclonal antibodies 4KB128 and OKT10 targeting CD22 and CD38 , respectively on normal and malignant lymphoid cells. This development work was undertaken with funding from the UK based charity Leukaemia Busters ref http leukaemiabusters.org.uk ref under the direction of Dr David Flavell , the charity s Scientific Director ref http www.leukaemiabusters.org.uk pages background.aspx ref The group disbanded in 2009 due to funding difficulties following the global economic crisis but despite this the former members continue to collaborate in areas of mutual interest. In this respect some of the group members and their respective institutes have recently entered into a collaboration agreement with the Italian pharmaceutical company Domp ref http www.dompe.com website ref based in L Aquila, central Italy with the intention of developing one of the RICG produced recombinant immunotoxins for investigation in early phase clinical trials for patients ... more details
of DNA repair nucleotide excision repair and recombinant fragments. LIG4 DNA ligase IV complexes ... molecular biology research for generating RecombinantDNArecombinantDNA sequences. For example, DNA ...Refimprove date February 2007 enzyme Name DNA ligase EC number 6.5.1.1 CAS number 9015 85 4 IUBMB EC number 6 5 1 1 GO code 0003910 image DNA Ligase.jpg width caption DNA ligase I protein Name ligase I, DNA, ATP dependent caption image width 200 HGNCid 6598 Symbol LIG1 AltSymbols EntrezGene 3978 OMIM ... Name ligase III, DNA, ATP dependent caption image width HGNCid 6600 Symbol LIG3 AltSymbols EntrezGene ... LocusSupplementaryData q12 protein Name ligase IV, DNA, ATP dependent caption image width HGNCid 6601 ... 13 Arm q Band 33 LocusSupplementaryData q34 In molecular biology , DNA ligase is a special ... in double stranded DNA molecules, in simple words strands that have double strand break a break in both complementary strands of DNA . Purified DNA ligase is used in gene cloning to join DNA ... type of DNA ligase using the Complementary DNA complementary strand as a template Citation needed date April 2010 but still requires DNA ligase to create the final phosphodiester bond to fully repair the DNA. DNA ligase has applications in both DNA repair and DNA replication see DNA ligase Mammalian ligases Mammalian ligases . In addition, DNA ligase has extensive use in molecular biology laboratories for Genetic recombination experiments see DNA ligase Applications in molecular biology research Applications in molecular biology research . Ligase mechanism The mechanism of DNA ligase is to form ... and the 3 hydroxyl of the acceptor. ref name pmid4377758 cite journal author Lehman IR title DNA ligase ... a ligase works with DNA end sticky end s Image Ligation.svg 400px Ligase will also work with DNA end ... ligases This section is linked from DNA ligase In mammals, there are four specific types of ligase. LIG1 DNA ligase I ligates the nascent DNA of the Replication fork Lagging strand lagging strand ... more details
DNA to transform cells has spawned the discipline of transgenesis the use of recombinantDNA techniques ...Unreferenced date February 2007 Exogenous DNA refers to any DNA deoxyribonucleic acid that originates outside of the organism of concern or study. The introduction of exogenous DNA into a cell is called transfection . This can take place naturally, as occurs when a virus infects cells, or artificially. Methods of artificial transfection include a chemical methods, including calcium phosphate precipitation, DEAE dextran complexation and lipid mediated DNA transfer b physical methods, including electroporation, microinjection, and biolistic particle delivery gene gun and c using recombinant, lab manipulated viruses as vectors. The process by which cells take up exogenous DNA from the outside is called Transformation genetics transformation . Bacteria need to be in a certain physiological state to successfully take up exogenous DNA, which is described as one of competence. Some bacteria are naturally competent, but usually only for a brief time at a certain stage of their growth cycle. Bacteria can also be made competent through a variety of chemical treatments including exposure to calcium ions, or a mixture of polyethylene glycol and dimethylsulfoxide, which make the cell membrane more permeable, leading to the uptake of the exogenous DNA. Another treatment method is the ustilisation of electricity as the membrane permeabilizing agent electroporation or electrotransformation . Finally, liposome mediated transformation can be used. In this method DNA is coated with lipid. Fusion of this lipid and the membrane lipid can occur, facilitating the entry of DNA. Transformation of bacteria ... of exogenous DNA is used to identify genes because the introduced DNA can act cause a mutation ..., often employs retrovirus es as the vectors of DNA delivery. Such insertion mutagenesis has ... rejection. Category DNA ... more details
of defined protein antigen s such as tetanus or diphtheria toxoid or RecombinantDNArecombinant ... and recombinant adenovirus vectors. ref name Lewis1999 The method of delivery determines the dose of DNA ... Infections rowspan 2 colspan 3 Method of Immunization DNA Vaccine Recombinant protein ... raised by DNA vaccination are lower than those obtained after vaccination with a recombinant protein. However, DNA immunization induced antibodies show greater affinity to native epitopes than recombinant ... response. Antibody can be induced after just one vaccination with DNA, whereas recombinant protein ... natural infection or recombinant protein immunization. Antibody responses generated by DNA are useful ... Plasmid DNA and Boosting with Antigen Expressing Recombinant Poxvirus 1 2 journal The Journal of Immunology ...Image Making of a DNA vaccine.jpg thumb 250px right The making of a DNA vaccine. DNA vaccination is a technique ... DNADNA to produce an immunological response . Nucleic acid vaccines are still experimental, and have ... tumour models. DNA vaccines have a number of advantages over conventional vaccines, including ... HL, Pertmer TM title DNA vaccines for viral infections basic studies and applications journal Adv. Virus ... title DNA vaccines technology and application as anti parasite and anti microbial agents journal Adv ... H sub and antibody responses, but not killer T cell responses. DNA vaccines are third generation vaccines , and are made up of a small, circular piece of bacterial DNA called a plasmid that has been ... DNA is injected into the cells of the body, where the inner machinery of the host cells reads the DNA ..., which then triggers a range of immune responses. ref name Robinson2000 ref name Alarcon1999 These DNA ... bird flu DNA vaccine tt ref cite news first Kirsty last Barnes coauthors title First positive results for DNA based flu vaccine date 2004 06 07 publisher url http www.in pharmatechnologist.com news ng.asp?n 68225 powermed bird flu vaccine dna work in PharmaTechnologist pages accessdate language ref ... more details
Onesource date June 2009 DNA end or sticky end refers to the properties of the end of a molecule of DNA or a recombinantDNA molecule. The concept is important in molecular biology , especially in Clone genetics cloning or when subcloning inserts DNA into vector DNA. All the terms can also be used in reference ... ends can anneal, even those from two different organisms. This bondage is temporary however, and DNA ... to join the two molecules together. Single stranded DNA molecules A single stranded non circular DNA molecule has two non identical ends, Directionality molecular biology the 3 end and the 5 end ... atoms in the deoxyribose , which is a sugar forming an important part of the backbone of the DNA molecule. In the backbone of DNA the 5 carbon of one deoxyribose is linked to the 3 carbon of another ..., and so forth. Variations in double stranded molecules When a molecule of DNA is double stranded, as DNA ... DNA end of a double stranded molecule is called a blunt end . In a blunt ended molecule both strands terminate in a base pair . Blunt ends are not always desired in biotechnology since when using a DNA ... subcloning, it also has the disadvantage of potentially inserting the insert DNA in the opposite ... is an example of a small piece of blunt ended DNA 5 font color red CTGATCTGACTGATGCGTATGCTAGT font ... by various overhangs . An overhang is a stretch of unpaired nucleotide s in the end of a DNA molecule ... often adenosine and is created as a 3 overhang by some DNA polymerase s. Most commonly this is used in cloning PCR products created by such an enzyme. The product is joined with a linear DNA ... they cut DNA. Very often they cut the two DNA strands four base pairs from each other, creating a four ... endonucleases usually create different overhangs, it is possible to cut a piece of DNA with two different enzymes and then join it with another DNA molecule with ends created by the same enzymes. Since ... each single strand of DNA, we typically see adenine pair with thymine , and cytosine pair with guanine ... more details
DNADNA hybridization generally refers to a molecular biology technique that measures the degree of genetic similarity between pools of DNA sequences. It is usually used to determine the genetic distance between two species . When several species are compared that way, the similarity values allow the species to be arranged in a phylogenetic tree it is therefore one possible approach to carrying out molecular systematics . Charles Sibley and Jon Ahlquist , pioneers of the technique, used DNADNA hybridization to examine the phylogenetic relationships of avians the Sibley Ahlquist taxonomy and primates. ref http evolution.berkeley.edu evolibrary article 0 history 26 Genetic Similarities Wilson, Sarich, Sibley, and Ahlquist ref ref cite journal title The Phylogeny of the Hominoid Primates, as Indicated by DNADNA Hybridization author C.G. Sibley and J.E. Ahlquist journal Journal of Molecular ... DNA hybridization in the apes Technical issues ref DNA sequencing and computational comparisons ... DNADNA hybridization to study complex microbial ecosystems author S.S. Socransky, A.D. Haffajee ... The DNA of one organism is labeled, then mixed with the unlabeled DNA to be compared against. The mixture is incubated to allow DNA strands to dissociate and reanneal, forming hybrid double stranded DNA ..., a process known as DNA melting . To assess the melting profile of the hybridized DNA, the double stranded DNA is bound to a column and the mixture is heated in small steps. At each step, the column ... labeled DNA comes off the column reflects the amount of similarity between sequences and the self ... . Fundamentals of Molecular Evolution. a good text on these topics See also DNA melting Temperature gradient gel electrophoresis Category Molecular biology Category DNA fr Hybridation de l ADN hu DNS DNS hibridiz ci nl DNADNA hybridisatie ja DNADNA pt Hibridiza o de DNADNA sv DNADNA hybridisering tr DNADNA hibridizasyon ... more details
Ask DNA could be Ask DNA album Ask DNA album , the soundtrack to Cowboy Bebop The Movie Ask DNA song Ask DNA song , the theme song to the aforementioned film disambig ... more details
of recombinantDNA technology, which permits isolation of defined fragments of DNA prior to this, the only ...pp move indef small yes Genetics2 The term DNA sequencing is commonly applied to several methods and technologies ... , and thymine in a molecule of DNA . Knowledge of DNA sequences has become indispensable for basic biological research, other research branches utilizing DNA sequencing, and in numerous applied ... of DNA sequencing has significantly accelerated biological research and discovery. The rapid speed of sequencing attained with modern DNA sequencing technology has been instrumental in the sequencing ... across continents, have generated the complete DNA sequences of many animal, plant, and microbial genomes. The first DNA sequences were obtained in the early 1970s by academic researchers using laborious ... cgi pmidlookup?view long&pmid 7678018 ref DNA sequencing has become easier and orders of magnitude ... pmid 1264203 doi 10.1038 260500a0 ref Prior to the development of rapid DNA sequencing methods in the early ... nobel prizes chemistry laureates 1980 gilbert lecture.pdf DNA sequencing and gene structure . Nobel ... Sanger75 cite journal author Sanger F, Coulson AR title A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase journal J. Mol. Biol. volume 94 issue 3 pages 441 8 year ..., Nicklen S, Coulson AR title DNA sequencing with chain terminating inhibitors journal Proc. Natl. Acad ... a DNA sequencing method based on chemical modification of DNA and subsequent cleavage at specific ... DNA journal Proc. Natl. Acad. Sci. U.S.A. volume 74 issue 2 pages 560 4 year 1977 month February ... 1980 sanger lecture.pdf Determination of nucleotide sequences in DNA . Nobel lecture, 8 December 1980. ref Maxam Gilbert sequencing rapidly became more popular, since purified DNA could be used directly ... stranded DNA. However, with the improvement of the chain termination method see below , Maxam Gilbert ... radioactive labeling at one 5 end of the DNA typically by a kinase reaction using gamma sup 32 sup ... more details
DNA synthesis commonly refers to DNA replication DNA biosynthesis in vivo DNA amplification Polymerase chain reaction enzymatic DNA synthesis in vitro DNA amplification Oligonucleotide synthesis chemical synthesis of nucleic acids Gene synthesis physically creating artificial gene sequences disamb ... more details
DNA.png thumb Cross linked DNA extracted from the 4,000 year old liver of an Ancient Egyptian priest Called Nekht Ankh. Ancient DNA is DNA isolated from ancient specimen s. ref Bioinformatics and Functional ... as any DNA recovered from biological samples that have not been preserved specifically for later DNA analyses. Examples include the analysis of DNA recovered from archaeological and historical ... on. Unlike modern genetic analyses, ancient DNA studies are characterised by low quality DNA . This places limits on what analyses can achieve. Furthermore, due to degradation of the DNA molecules ..., upper limits exist beyond which no DNA is deemed likely to survive. Current estimates suggest that in optimal ... DNA , for example, from Cretaceous dinosaur remains, have been proven to be wrong, with results stemming from sample or extract contamination, as opposed to authentic extracted DNA. History of Ancient DNA studies Arguably the first aDNA study was in 1984, with a publication by Russ Higuchi and colleagues at Berkeley that was to revolutionise the scope of molecular biology , traces of DNA from a museum ... R, Bowman B, Freiberger M, Ryder OA, Wilson AC title DNA sequences from the quagga, an extinct member ... to sequence such DNA through bacterial cloning were an effective brake on the development of the field of ancient DNA aDNA . However, with the development of the Polymerase chain reaction Polymerase ... name pmid3431465 cite journal author Mullis KB, Faloona FA title Specific synthesis of DNA in vitro ... Saiki RK, Gelfand DH, Stoffel S, et al. title Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase journal Science volume 239 issue 4839 pages 487 91 year 1988 month January ... abr. SPEX amplification was introduced in 2007 to address post mortem DNA modification damage ... of ancient DNA reveals C U type base modification events as the sole cause of post mortem miscoding ... deamination cytosine residues are vastly overrepresented in the ancient DNA sequences. Miscoding of C ... more details
wiktionary DNA TOCright DNA is a nucleic acid that contains the genetic instructions specifying the biological development of all cellular life. DNA may also refer to Business DNA Model Management , a modeling agency based in New York City DNA Productions , an American animation studio DNA Studio , an advertising agency DNA Oy , a Finnish telecommunications company Computing BitTorrent DNA , download accelerator Digital Network Architecture DNA , a peer to peer network architecture by Digital Equipement Corporation implemented into the DECnet protocols suite DNA computing , which uses deoxyribonucleic acid and molecular biology instead of a traditional silicon based computer technologies Windows DNA , a defunct predecessor of the Microsoft .NET Framework Music D.N.A. , a song by A Flock of Seagulls on their album A Flock of Seagulls album D.N.A. album D.N.A. album , the fourth studio album by American RnB singer Mario entertainer Mario DNA , a rock band formed in 1983 by Rick Derringer and Carmine Appice DNA band , a New York band DNA dance music band DNA Lounge , a nightclub in San Francisco ... DNA Magazine , an Australian magazine for gay men Les Derni res Nouvelles d Alsace , commonly referred to as Les DNA , French newspaper edited in Strasbourg Other uses DNA Red Dwarf DNA Red Dwarf TV episode DNA , a 15 episode anime series based on the manga by Masakazu Katsura Defense Nuclear Agency , a United States Department of Defense combat support agency DnA, a pen name used jointly by writers ... LA and multi agent systems MAS DNA, a nickname for Douglas Adams , whose middle name was Noel Senyo Amoaku D.N.A. , the pseudonym of American film actor Senyo Amoaku. See also DNA profiling disambig Interwikies de DNA Begriffskl rung es DNA desambiguaci n eo DNA apartigilo fa DNA fr DNA ko DNA it DNA disambigua nl DNA ja DNA no Dna nn DNA fleirtyding pl Dna ro DNA sk DNA fi DNA t smennyssivu sv DNA olika betydelser tr DNA anlam ayr m vi DNA nh h ng zh DNA ... more details
Unreferenced date February 2011 Nuclear DNA , nuclear deoxyribonucleic acid nDNA , is DNA contained within a cell nucleus nucleus of eukaryote eukaryotic organisms . In most cases it encodes more of the genome than the mitochondrial DNA and is passed sexually rather than matrilineally. Nuclear DNA is the most common DNA used in forensic examinations. See also Chromatin Nucleic acids DEFAULTSORT Nuclear Dna Category DNA Cell biology stub ar ca ADN nuclear fr ADN nucl aire pl NDNA pt DNA nuclear ... more details
orphan date September 2010 It is a DNA contained in organelle s, outside the cell nucleus nucleus of eukaryote Eukaryotic cells . Examples mitochondria contain mitochondrial DNA plastid s e.g., chloroplasts contain plastid DNA Structure Unlike nuclear DNA , which is present as linear molecule s inside the chromosome s, organellar DNA is present as circular molecules of high copy number. Also, because organelles are uniparentally inherited in many organisms, so is their organellar DNA. See also Nuclear DNA Category DNA biology stub ar ... more details
Encyclopedia
top
