The term RNAediting describes those molecular processes in which the information content in an RNA molecule ... in tRNA , rRNA , and mRNA molecules of eukaryotes but not prokaryotes . RNAediting occurs in the cell ... from prokaryotic like endosymbionts . Most of the RNAediting processes, however, appear to be evolutionarily recent acquisitions that arose independently. The diversity of RNAediting mechanisms ..., as well as non templated nucleotide additions and insertions. RNAediting in mRNAs effectively ... by insertion or deletion RNAediting through the addition and deletion of uracil has been found in kinetoplasts from the mitochondria of Trypanosoma brucei sup 2 4, 5 10 sup . Editing of the RNA starts ..., removes the unpaired Us. After editing has made mRNA complementary to gRNA, an RNA ligase rejoins ... RNA at a time. Therefore, a RNA transcript requiring extensive editing will need more than one guide RNA and editosome complex. Editing by deamination C U editing The editing involves cytidine deaminase .... It is unedited in the liver. Image Apobgene.PNG 300px thumb The Effect of C U RNAEditing on the Human ApoB gene A I editing A to I editing occurs in regions of double stranded RNA dsRNA . Adenosine deaminases acting on RNA ADAR s are the RNAediting enzymes involved in the hydrolytic deamination ... of miRNA and siRNA processing ,and altered splicing. RNAediting in plants It has been shown in previous studies that the only types of RNAediting seen in the plants mitochondria and plastids are conversion of C to U and U to C very rare sup 11 23 sup . RNAediting sites are found mainly in the coding regions of mRNA, introns , and other non translated regions 13 . In fact, RNAediting can restore ... for a deaminase. RNAediting is essential for the normal functioning of the plant s translation ... Functions of RNAEditingRNAediting in animals The first observation of RNAediting in the animal ... would dissociate. RNAediting is essential in the completion of some transcripts and ensures the proper ... more details
SNP database identifies recoding sites of A to I RNAediting journal RNA volume 14 issue 10 pages ... cgi pmidlookup?view long&pmid 18772245 ref RNAEDITING The two editing sites were previously ... RNAediting journal Nucleic Acids Res. volume 33 issue 4 pages 1162 8 year 2005 pmid 15731336 ... 15731336 ref Editing type A to I RNAediting is catalyzed by a family of adenosine deaminases acting on RNA ADARs that specifically recognize adenosines within double stranded regions of pre mRNAs and deaminate ... title Liver disintegration in the mouse embryo caused by deficiency in the RNAediting enzyme ADAR1 ... The A to G discrepancies for these two editing sites were confirmed experimentally to be RNAediting ..., continue to undergo editing as mature mRNA. A third candidate editing site did not show evidence of RNAediting in sequence analysis, which may be an indication that either the RNAediting process is tissue ... name pmid18772245 See also GABRA3 RNAEditing CYFIP2 RNAEDITING CYFIP2 RNAediting KCNA1 RNAediting KCNA1 RNAEditing ARL6IP4 RNAEditing BLCAP RNAEditing BLCAP RNAediting KCNA1 RNAediting FLNA RNAediting C1QL1 RNAediting References Reflist External sources http darned.ucc.ie Category RNAediting ... expressed in tissues while ADAR 3 is restricted to the brain.The double stranded regions of RNA are formed by base pairing between residues in the close to region of the editing site with residues usually in a neighboring intron but can be an exonic sequence.The region that base pairs with the editing region is known as an Editing Complentary Sequence ECS . It is thought that the pre mRNA of IGFBP7 is a substrate for ADAR1 based on the expression spectrum of the editing enzyme. ref name pmid14615479 ... 10.1074 jbc.M311347200 url http www.jbc.org cgi pmidlookup?view long&pmid 14615479 ref Editing sites The pre mRNA of this protein is edited at two posistions.These editing sites occur within the insulin .... The editing complementary sequence ECS is located in a region within the coding sequence about 200 ... more details
RNAeditingEditing type The type of editing A to I editing. Adenosine deaminase s acting on RNA ADARs are the RNAediting enzyme s involved in the editing of GRIA2 pre mRNA.ADARs deaminate adenosine bases to insosine bases in a site specific manner in double stranded RNA substrates dsRNA . ADA2 has been proven experimentally to be the editing enzyme. Editing site The pre mRNA of GRIA2 is modified at amino acid 607 founf in the second transmembrane domain of the receptor subunit. Editing regulation Editing occurs in 100 of transcripts from human brain but editing levels are less so in other tissues.Deletion analysis determined that editing requires 5 portion inton B. The predicted minimum fragment required for editing to occur contains inverted repeat structure separated by 120 nucleotides ... of the United States of America, 91, 10270 10274. ref Effects of Rnaediting Protein structure The genomically encoded GluR2 subunit has a Gln CAG at the editing site position. Editing of the pre ... editing Thiamine Vitamin B1 deficiency Deficiency of this vitamin has been shown to cause alterations in editing of Glur2 pre mRNA.Thiamine deficiency leads to mild impairment of oxidative metabolism .... Deficiency also inhibits editing of the Q R site of Glur2 thereby increasing the level of unedited ... more details
Orphan date February 2009 Rfam box acc RF00485 description Potassium channel RNAediting signal abbreviation K chan RES avg length 113.00 avg identity 61.00 type Cis reg se PMID 15361858 ss Published PMID 15361858 Moxon SJ release 10.0 The potassium channel RNAediting signal is an cis regulatory element RNA element found in human Kv1.1 and its homologues which directs the efficient modification of an adenosine to inosine by an adenosine deaminase acting on RNA ADAR . The ADAR modification causes an isoleucine valine recoding event which lies in the ion conducting pore of the potassium channel. It is thought that this editing event targets the process of fast inactivation and allows a more rapid recovery from inactivation at negative potentials. ref cite journal last Bhalla first T coauthors Rosenthal JJ, Holmgren M, Reenan R year 2004 title Control of human potassium channel inactivation by editing of a small mRNA hairpin journal Nat Struct Mol Biol volume 11 pages 950&ndash 956 pmid 15361858 doi 10.1038 nsmb825 issue 10 ref References reflist 1 External links Rfam id RF00485 name Potassium channel RNAediting signal Category Cis regulatory RNA elements molecular cell biology stub ... more details
RNA is one of the three major macromolecule s along with DNA and protein s that are essential for all known forms of life. Like DNA, RNA is made up of a long chain of components called nucleotide ... group. The sequence of nucleotides allows RNA to encode genetic information. For example, some virus es use RNA instead of DNA as their genetic material, and all organisms use messenger RNA mRNA to carry the genetic information that directs the synthesis of proteins. Like proteins, some RNA molecules play an active role in cells by catalyzing biological reactions, controlling gene expression ... of proteins on ribosome s. This process uses transfer RNA tRNA molecules to deliver amino acids to the ribosome, where ribosomal RNA rRNA links amino acids together to form proteins. The chemical structure of RNA is very similar to that of DNA , with two differences a RNA contains the sugar ... oxygen atom , and b RNA has the nucleobase uracil while DNA contains thymine uracil and thymine have similar base pairing properties . Unlike DNA, most RNA molecules are single stranded. Single stranded RNA molecules adopt very complex three dimensional structures, since they are not restricted to the repetitive double helical form of double stranded DNA. RNA is made within living cells by RNA polymerase s, enzyme s that act to copy a DNA or RNA template into a new RNA strand through processes known as Transcription genetics transcription or RNA replication , respectively. Comparison with DNA ... subunit. RNA is in ochre, protein in blue. The active site is in the middle red . RNA and DNA are both ... stranded, RNA is a single stranded molecule in many of its biological roles and has a much shorter chain of nucleotides. Second, while DNA contains deoxyribose , RNA contains ribose in deoxyribose there is no hydroxyl ... groups make RNA less stable than DNA because it is more prone to hydrolysis . Third, the complementary ..., including mRNA , tRNA , rRNA , snRNA s, and other non coding RNA s, contain self complementary sequences ... more details
wiktionary photo wiktionary editing Photo editing can refer to Image editing techniques applied to photographs. The cultural impact and ethical concerns of photo manipulation . See also Image processing disambig ... more details
Simultaneous editing may refer to a technique in the Lapis text editor Lapis text editor that allows the user to manipulate all items in a multiple selection at once through direct manipulation. collaborative editing of the same document by several users in workgroup tools. disambig ... more details
In camera editing is the technique in filmmaking of shooting Filmmaking Production shots in the exact sequence that they will be seen on movie theater screen . This means planning in advance what shots will tell the desired story and then shooting only those shots in that order, as opposed to the usual filmmaking technique of shooting multiple take s out of sequence, then film editingediting them into order to tell the story. ref cite web url http www.personal.kent.edu lhanson incamera.htm title In Camera Editing accessdate 2008 03 20 last Hanson first LuEtt work Videography Basics Online Textbook publisher Kent State University ref References reflist Category Film and video technology filming stub ... more details
Cleanup date April 2008 Image Mesa de v deo 1.JPG right thumb A vision mixer. The term video editing can refer to non linear editing system , using computers with video editing software linear video editing , using videotape vision mixing , when working with live video signals Background Video editing is the process of editing segments of motion video footage, special effects and sound recordings. Motion picture film editing is a predecessor to video editing and, in several ways, video editing simulates motion picture film editing, in theory and the use of non linear and linear editing systems. Using vid a director can communicate non fictional and fictional events. The goals of editing is to manipulate these events for better or for worse communication. It is a visual art. Early video recorders were so expensive, and the quality degradation caused by copying was so great, that 2 inch Quadruplex videotape was edited by visualizing the recorded track with ferrofluid and cutting with a razor ... already recorded on an existing tape. This technique was referred to as linear editing. If a scene ... source VCRs or EditDroid LaserDisc players , but modern non linear editing systems use video digitally ... Movies, iPod, CD ROM , or videotape . Home Video Editing Like many other technologies, the cost of video editing has declined by an order of magnitude or more. The 2 Quadraplex system cost so much that many television production facilities could only afford a single unit and editing was a highly involved ... retail operating systems include basic video editing software Apple Inc. Apple s iMovie and Microsoft ... autoProducer. Additionally, there are free opensource video editing programs. These include Kdenlive , PiTiVi , Kino software Kino , Openshot and Cinelerra . See also Film editing Video server Video editing software Photo slideshow software Video remix Video scratching Edit Decision List Mashup ... de v deo fr Montage vid o ko it Video editing he pt Edi o de v deo sv Videoredigering ... more details
Unreferenced date December 2009 Wikify date August 2009 Online editing is generally the final stage of video editing . When the offline editing offline edit is complete, the pictures are re assembled at full or online resolution . An edit decision list or equivalent is used to carry over the cuts and dissolves from the offline. Projects may be re captured at the lowest level of Video compression compression possible ideally with no compression at all. This conform is checked against a video copy of the offline edit to verify that the edits are correct and frame accurate. This cutting copy also provides a reference for any video effects that need to be added. After conforming the project, the online editor will add visual effects , titles, and apply color correction , a process known as flapjacking . This process is typically supervised by the client s . The editor will also ensure that the program meets the technical delivery specs of the broadcaster, ensuring proper video levels, aspect ratio, and blanking width. Sometimes the online editor will package the show, putting together each version. Each version may have different requirements for the formatting i.e. closed blacks , use of bumpers, different credits, etc. DEFAULTSORT Online Editing Category Film and video technology ... more details
Selfref For copy editing on Wikipedia, see Wikipedia How to copy edit . Journalism Copy editing also written as copy editing or copyediting , and sometimes abbreviated to ce is the work that an editing editor does to improve the format ting, style and accuracy of text. Unlike general editing, copy editing often does not involve changing the substance of the text. copy written Copy refers to written or typewritten text for typesetting , printing , or publication . Copy editing is done before proofreading , which is the last step in the editorial cycle. In the United States and Canada, an editor ... make it say what it means, and mean what it says . Typically, copy editing involves correcting misspelling ... and footers , and photo caption s. And although proofreading is a distinct task from copy editing .... The nearly universal adoption of computerised systems for editing and layout in newspapers ... in recent years, some news organizations are lowering the emphasis on editing, though at the expense ... studies communications . In the United States, copy editing is often taught as a college ... . Most U.S. newspapers and publishers give copy editing job candidates an editing test or a tryout ... editing, and journalism ethics . In both the U.S. and the U.K., there are no official bodies ... AP Stylebook Editing ColBreak Fact checker Headline House style News design ColBreak Photo caption Proofreading Robinson Prize EndMultiCol Notes Reflist References The Art of Editing, by Floyd K. Baskette ... Caroline last3 Leach first3 Maureen title Butcher s Copy editing The Cambridge Handbook for Editors ... Sub editing style and directory UK http www.pgdp.net Proofreading practice at Project Gutenberg Distributed ... Society for Editors and Proofreaders UK http www.stc techedit.org Technical Editing special interest group SIG of the Society for Technical Communication STC Newspaper copy editing The Slot, includes ... Post Category Copy editing Category Technical communication Category Writing occupations Category Journalism ... more details
Film editing is part of the process of filmmaking . It involves the selection and combining of Shot filming ... . It is an art of storytelling . Film editing is the only art that is unique to cinema, separating film ... director directing , although there are close parallels to the editing process in other art forms like poetry or novel writing. Film editing is often referred to as the invisible art Citation ... or she is not even aware of the editor s work. On its most fundamental level, film editing is the art ... who practices film editing by assembling the footage. However, the job of an editor isn t simply to mechanically ... editing, film editors and their assistants have become responsible for many areas of filmmaking that used ... of other aspects of the editing process, usually under the direction of the picture editor and director ... effects teams hired to complete the picture. Film editing is an art that can be used in diverse ways ... S. Porter is generally thought to be the American filmmaker who first put film editing to use. Porter ... street. There was no story and no editing. Each film ran as long as there was film in the camera ... is still shown in film schools today as an example of early editing form. It was produced in 1903 and was one of the first examples of dynamic, action editing the piecing together scenes shot at different ... editing technology Image FirstMoviola.jpg thumb 250px The original editing machine an upright Moviola . Image Steenbeck rollers.jpg thumb 250px Steenbeck film editing machine rollers Before the widespread use of non linear editing system s, the initial editing of all films was done with a positive ... editing see also Online editing There are several editing stages and the editor s cut is the first ..., and often the entire editing process goes on for many months and sometimes more than a year, depending ... editing technique. There are at least three senses of the term In French film practice, montage has its literal French meaning assembly, installation and simply identifies editing. In Soviet film ... more details
unreferenced date May 2008 Offline editing is the film and television post production process in which raw footage is copied and edited, without affecting the camera original film or tape. Once a programme has been completed in offline, the original media will be conformed, or on lined, in the online editing stage. Modern offline editing is conducted in a non linear editing suite. The digital revolution has made the offline editing process immeasurably quicker, as practitioners moved from time consuming linear tape to tape suites, to computer hardware and software such as Adobe Premiere , Final ... are then free to work with all the options to create the final cut. History From film to tape Film editing ... scenes together, not for creative editing. The second option for video editing was to use two ... from Communication source source to edit master came to be known as linear video editing . This was the way ... developments Three developments of the late sixties and early seventies revolutionized video editing ... frame numbers by watching this tape. Exact editing Though both of these developments helped greatly, effectively creating the offline editing method, they didn t solve the problem of precisely controlling the video recorder for frame accurate editing. That required precise control of the tape transport ... of the CBS and Memorex corporations. The intent was to create a much less haphazard method of editing video directly that had all of the creative control of traditional film editing. The result ..., re editing was trivial, as no cuts were actually performed. The shots were simply accessed and played ... disc pack and this first attempt at non linear editing on video was abandoned as too expensive ... the online editing suite with an EDL and master source tapes, to finish the broadcast quality version of the show. External links http www.sssm.com editing museum The Museum of Early Video Editing ... Editing Category Film and video technology ... more details
Main Film editing Refimprove date November 2009 Original research date March 2010 Continuity editing is the predominant style of film editingediting in narrative cinema and television. The purpose of continuity editing is to smooth over the inherent discontinuity of the editing process and to establish a logical coherence between shots. In most films, logical coherence is achieved by cutting to continuity, which emphasizes smooth transition of time and space. However, some films incorporate cutting to continuity into a more complex classical cutting technique, one which also tries to show psychological continuity of shots. The Montage filmmaking montage technique relies on symbolic association of ideas between shots rather than association of simple physical action for its continuity. Common techniques of continuity editing Continuity editing can be divided into two categories temporal continuity and spatial continuity. Within each category, specific techniques will work against a sense of continuity. In other words, techniques can cause a passage to be continuous, giving the viewer a concrete physical narration to follow, or discontinuous, causing viewer disorientation, pondering ... film dissolve and the fade. Other editing styles can show a reversal of time or even an abandonment ... viewer disorientation in editing is to adhere to the 180 degree rule. The rule prevents the camera ..., but under the principle of spatial continuity editing, crosscutting is considered a technique of spatial ... editing Discontinuous editing describes the deliberate or accidental violation of rules of continuity when Film editingediting films . As a deliberate technique, it may be used to connote authenticity ... 22 ref It is also known as montage editing , and employs a series of often rapid and non matching ... Discontinuity editing Montage sequence Montage film Continuity Editing DEFAULTSORT Continuity Editing Category Film editing de Unsichtbarer Schnitt he nl Continu teitsmontage ... more details
Distinguish simultaneous editing Collaborative editing is the practice of groups producing works together through individual contributions. Effective choices in group awareness, participation, and coordination are critical to successful collaborative writing outcomes. ref Lowry, Paul Benjamin, Aaron Mosiah Curtis and Michelle Rene Lowry. http papers.ssrn.com sol3 papers.cfm?abstract id 666141 A Taxonomy of Collaborative Writing to Improve Empirical Research, Writing Practice, and Tool Development, Journal of Business Communication JBC , Vol. 41, No. 1, pp. 66 99, 2004. ref Most usually it is applied to textual documents or programmatic source code . Such asynchrony asynchronous non simultaneous contributions are very efficient in time, as group members need not assemble in order to work together. Generally, managing such work requires software ref Kuutti, Kari et al. 2003 . http books.google.com books?id F 3RxNdMUNQC&pg PA315&dq collaborative editing&client firefox a v onepage&q collaborative 20editing&f false ECSCW 2003 proceedings of the Eighth European Conference on Computer Supported Cooperative Work, p. 315. ref the most common tools for editing documents are wiki s, and those for programming, version control system s. Most word processor s are also capable of recording changes this allows editors to work on the same document while automatically clearly labeling who contributed what changes. Wikipedia is an example of a collaborative editing project on a large scale. Notes reflist References Kuutti, Kari, Eija Helena Karsten, Paul Dourish, Geraldine Fitzpatrick and Kjeld Schmidt. 2003 . ECSCW 2003 proceedings of the Eighth European Conference on Computer Supported Cooperative Work 14 18 September 2003, Helsinki, Finland . London Springer Verlag Kulwer . 10 ISBN 1 402 ... Collaborative real time editor Wikiversity Collaborative play writing DEFAULTSORT Collaborative Editing Category Collaboration Category Editing network software stub id Penyuntingan kolaboratif it Scrittura ... more details
Receptor editing is a process that occurs during the maturation of B cells , which are part of the adaptive immune system. This process has the aim to change the specificity of the antigen receptor of immature B cells, in order to rescue them from programmed cell death, called apoptosis . During maturation in the bone marrow, B cells are tested for interaction with self antigens, which is called negative selection . If the maturing B cells strongly interact with these self antigens, they undergo death by apoptosis. Negative selection is important to avoid the production of B cells that could cause autoimmune diseases . They can avoid apoptosis by modifying the sequence of light chain V and J genes components of the antigen receptor so that it has a different specificity and may not recognize self antigens anymore. This process of changing the specificity of the immature B cell receptor is called receptor editing. References cite book last Abbas first Abul K. authorlink DaAbul K. Abbas title Basic immunology 2nd updated edition publisher Saunders Elsevier series year 2006 2007 doi isbn 1416029745 Category Cells ... more details
about the uses, cultural impact, and ethical concerns of image editing Photo manipulation the process of culling and archiving images Digital asset management Refimprove date May 2008 Image editing encompasses the processes of altering image s, whether they be Digital photography digital photograph s, traditional Photographic processing analog photograph s, or illustration s. Traditional analog image editing is known as Retouching photo retouching , using tools such as an airbrush to modify photographs, or editing illustrations with any traditional art medium . Graphic software programs, which can be broadly grouped into vector graphics editor s, raster graphics editor s, and 3d modeler s, are the primary tools with which a user may manipulate, enhance, and transform images. Many image editing programs are also used to artistic rendering render or create computer art from scratch. File Editimage.jpg thumb Image Edit right An example of selective color change Basics of image editing Raster ... . Automatic image enhancement Camera or computer image editing programs often offer basic automatic ... editing features, such as Red eye effect red eye removal, sharpness adjustments, Digital zoom zoom ... from a menu. Additionally, some automatic editing features offer a combination of editing actions ... and channel based extraction. Layers main Layers digital image editing Another feature common to many graphics applications is that of Layers digital image editing Layers , which are analogous to sheets ..., and enables maximum flexibility for the user while maintaining non destructive editing principles and ease ... Layers digital image editing layers . The background image is used as the bottom layer, and the image ... of images A more recent tool in digital image editing software is the image slicer. Parts of images ... image. Contrast change and brightening File Photo editing contrast correction.jpg left thumb 250px .... Refend DEFAULTSORT Image Editing Category Digital photography Category Graphic design Category Image ... more details
mRNA s in kinetoplastid protist s in a process known as RNAediting . Overview of gRNA directed editing Trypanosomatid protists and other kinetoplastid s have a novel post transcriptional mitochondrial RNA modification process known as RNAediting . The mitochondrial genome in these cells consists ... by short guide RNA gRNAs which encode the editing information in the form of complementary ... using this process. One such gene is Cyb. ref cite web title Uridine insertion deletion RNAediting ... information that corrects errors in the other genome, is novel. Editing proceeds generally 3 to 5 on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of ribonucleoprotein ... the duplex upstream. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites an editing block , the editing of which ... gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing domain . In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3 side, probably due to the loss of minicircle sequence classes ... cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary ... is now repaired by adding U s at each editing site in succession, giving the sequence gRNA 3 AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA ... gene has two overlapping gRNA editing sites. The 5 end of this section is the 3 anchor for another gRNA gCyb II gRNA . References Refimprove date November 2009 reflist nucleic acids Category RNA ru GuideRNA zh RNA ... more details
RNA journal may refer to RNA journal , a Cold Spring Harbor Laboratory Press scientific journal RNA Biology , a Landes Bioscience scientific journal disambig ... more details
Pfam box Symbol RNA pol flaviviral Name RNA directed RNA polymerase, flaviviral Pfam PF00972 InterPro IPR000208 PROSITE PDB RNA dependent RNA polymerase RdRP , RDR , or RNA replicase , is an enzyme EC number 2.7.7.48 that catalyzes the Self replication replication of RNA from an RNA template. This is in contrast to a typical DNA dependent RNA polymerase , which catalyzes the transcription genetics transcription of RNA from a DNA template. RNA directed RNA polymerase RdRp is an essential protein encoded in the genomes of all RNA containing viruses with no DNA stage. ref name pmid2759231 cite journal author Koonin EV, Gorbalenya AE, Chumakov KM title Tentative identification of RNA dependent RNA polymerases of dsRNA viruses and their relationship to positive strand RNA viral polymerases journal ... title A reevaluation of the higher taxonomy of viruses based on RNA polymerases journal J. Virol. volume ... synthesis of the RNA strand complementary to a given RNA template. The RNA replication process is a two step mechanism. First, the initiation step of RNA synthesis begins at or near the 3 end of the RNA ... RNA product. ref name pmid11531403 cite journal author Kao CC, Singh P, Ecker DJ title De novo initiation of viral RNA dependent RNA synthesis journal Virology volume 287 issue 2 pages 251 ..., notavirus, etc. supergroup of RNA viruses. Primer dependent RNA synthesis utilizes a small 2 to 3 ... is covalently bound to the 5 end of the RNA template. VPg facilitates synthesis at the 3 end of the template ... is a RNA stem loop structure, serves as a template for the uridylylation of VPg, resulting in the synthesis of VPgpUpUOH. Mutations within the CRE RNA structure prevent VPg uridylylation, and mutations ... RNA dependent RNA polymerase complexes with VPg journal Biochemistry Mosc. volume 74 issue 10 pages ... negative strand RNA synthesis in a CRE and VPgpUpUOH independent manner, CRE dependent VPgpUpUOH synthesis is absolutely required for positive strand RNA synthesis. CRE dependent VPg uridylylation lower ... more details
RNA stands for ribonucleic acid, a biological macromolecule. RNA may also refer to RNA journal , a scientific journal Religion Newswriters Association Republic of New Afrika , a black nationalist community and political lobby group Rochester Numismatic Association Romantic Novelists Association The Royal National Agricultural and Industrial Association of Queensland , organiser of the Ekka Royal Navy Association , a form of auxiliary for the Royal Navy United Kingdom Royal Nepalese Army Royal Nepal Airlines disambig es RNA desambiguaci n eo RNA apartigilo fr RNA gl RNA it RNA disambigua zh RNA ... more details
Orphan date February 2009 Unreferenced date January 2008 Preribosomal RNA is a non complete RNA that serve as the intermediate form during RNA biogenesis. Long comment to avoid being listed on short pages Category RNA Cell biology stub ... more details
Image MRNA interaction.png thumb 300px The life cycle of an mRNA in a eukaryotic cell. RNA is transcription .... Messenger RNA mRNA is a molecule of RNA encoding a chemical blueprint for a protein product. mRNA ... . This process requires two other types of RNA transfer RNA tRNA mediates recognition of the codon and provides the corresponding amino acid, while ribosomal RNA rRNA is the central component of the ribosome ... molecules do not. Transcription main Transcription genetics During transcription, RNA polymerase makes .... One notable difference, however, is that prokaryotic RNA polymerase associates with mRNA processing ... termed an RNA cap, an RNA 7 methylguanosine cap or an RNA m sup 7 sup G cap is a modified guanine nucleotide that has been added to the front or 5 end of a eukaryotic messenger RNA shortly after the start ..., the 5 end of the mRNA being synthesized is bound by a cap synthesizing complex associated with RNA ... is usually performed by an RNA protein complex called the spliceosome , but some RNA molecules are also capable of catalyzing their own splicing see ribozyme s . Editing In some instances, an mRNA will be RNAediting edited , changing the nucleotide composition of that mRNA. An example in humans is the apolipoprotein B mRNA, which is edited in some tissues, but not others. The editing creates an early ... Polyadenylation is the covalent linkage of a polyadenylyl moiety to a messenger RNA molecule. In eukaryotic organisms, most messenger RNA mRNA molecules are polyadenylated at the 3 end. The messenger RNA Poly A tail poly A tail and the protein bound to it aid in protecting mRNA from degradation ... occurs during and immediately after transcription of DNA into RNA. After transcription has been terminated, the mRNA chain is cleaved through the action of an endonuclease complex associated with RNA ..., Burge CB title Widespread selection for local RNA secondary structure in coding regions of bacterial ... by the 5 UTR and or 3 UTR due to varying affinity for RNA degrading enzymes called ribonuclease ... more details
Orphan date February 2009 Rfam box acc RF00240 description RNA OUT abbreviation RNA OUT avg length 69.90 avg identity 94.00 type Gene antisense se PMID 2482367 , INFERNAL ss Predicted Pfold release 10.0 RNA OUT is a non coding RNA that is antisense to the RNA IN non coding RNA. Transposition of insertion sequence IS10 is regulated by an anti sense RNA which inhibits transposase expression when IS10 is present in multiple copies per cell. RNA OUT consists of a stem loop domain topped by a flexibly paired loop the 5 end of the target molecule, RNA IN, is complementary to the top of the loop, and complementarity extends for 35 nucleotides down one side of RNA OUT. ref cite journal last Kittle first JD coauthors Simons RW, Lee J, Kleckner N year 1989 title Insertion sequence IS10 anti sense pairing initiates by an interaction between the 5 end of the target RNA and a loop in the anti sense RNA journal J Mol Biol volume 210 pages 561&ndash 572 pmid 2482367 doi 10.1016 0022 2836 89 90132 0 issue 3 ref References reflist 1 External links Rfam id RF00240 name RNA OUT Category Non coding RNA molecular cell biology stub ... more details
year 2006 pmid 16705157 doi 10.1128 MCB.02189 05 pmc 1489094 ref Crosstalk with RNAediting The type of RNAediting that is most prevalent in higher eukaryotes converts adenosine nucleotides into inosine ... B title RNAediting by adenosine deaminases that act on RNA journal Annu Rev Biochem volume 71 issue ... proposed in 2000 that the RNAi and A I RNAediting pathways might compete for a common ... S0092 8674 02 71133 1 ref Indeed, some pre miRNAs do undergo A I RNAediting, ref name Luciano 2004 cite journal author Luciano D, Mirsky H, Vendetti N, Maas S title RNAediting of a miRNA precursor ... P, Shiekhattar R, Nishikura K title Modulation of microRNA processing and expression through RNAediting ... C. elegans strains indicating that A I RNAediting may counteract RNAi silencing of endogenous genes ... crosstalk between RNAediting and RNA interference journal Nat Rev Mol Cell Biol volume 7 issue 12 ... of RNA interference in mammalian cells. RNA interference RNAi is a system within living cells ... RNA molecules microRNA miRNA and small interfering RNA siRNA are central to RNA interference. RNAs are the direct ... increase or decrease their activity, for example by preventing a messenger RNA from producing a protein. RNA interference has an important role in defending cells against parasitic genes virus es and transposon ... Dicer , which cleaves long RNA Double stranded RNA double stranded RNA dsRNA molecules into short ... into the RNA induced silencing complex RISC . The most well studied outcome is post transcriptional ... RNA molecule and induces cleavage by Argonaute , the catalytic component of the RISC complex ... is also a promising tool in biotechnology and medicine . Historically, RNA interference ... in Physiology or Medicine for their work on RNA interference in the nematode worm C. elegans , ref name Daneholt2006 cite web title Advanced Information RNA interference last Daneholt first Bertil work ... interference by double stranded RNA in Caenorhabditis elegans journal Nature volume 391 issue 6669 ... more details
Encyclopedia
top
