A hormoneresponseelement HRE is a responseelement for hormones , a short sequence of DNA within the Promoter biology promoter of a gene that is able to bind a specific hormone receptor complex and therefore regulate Transcription genetics transcription . ref name web1 Cite web url http users.rcn.com jkimball.ma.ultranet BiologyPages S SteroidREs.html title Steroid Hormone Receptors and their Response Elements accessdate 2006 11 09 ref The sequence is most commonly a pair of inverted repeat s separated by three nucleotides, which also indicates that the receptor binds as a protein dimer dimer . A gene may have many different response elements, allowing complex control to be exerted over the level and rate of transcription. ref name isbn0 7167 4366 3 cite book author Monty Krieger Matthew P Scott Matsudaira, Paul T. Lodish, Harvey F. Darnell, James E. Lawrence Zipursky Kaiser, Chris Arnold Berk title Molecular Cell Biology, Fifth Edition publisher W. H. Freeman location San Francisco year 2003 isbn 0 7167 4366 3 oclc doi page 973 pages ref HRE are used in transgenic animal cells as Inducer biology inducer of gene expression. References div class references small references div Category Gene expression genetics stub de ResponseElement es Elemento de respuesta a hormonas fr l ment de r ponse biologie mol culaire ... more details
Response elements are short sequences of DNA that are able to bind a specific transcription factor s and regulate Transcription genetics transcription of gene s. Examples Examples of response elements include Hormoneresponseelement cAMP responseelement External links MeshName responseelement Category DNA Biochemistry stub Transcription ... more details
Image FerritinRNA 2ipy.png thumb 200px left A 3D representation of the iron responseelement. This is part of ferritin mRNA with the iron responsive element IRE shown in yellow, after PDB 2IPY. ref name pmid16511314 cite journal author Selezneva AI, Cavigiolio G, Theil EC, Walden WE, Volz K title Crystallization and preliminary X ray diffraction analysis of iron regulatory protein 1 in complex with ferritin IRE RNA. journal Acta Crystallogr Sect F Struct Biol Cryst Commun volume 62 issue Pt 3 pages 249 52 year 2006 pmid 16511314 doi 10.1107 S1744309106004192 pmc 2197192 ref ref name pmid17185597 cite journal author Walden WE, Selezneva AI, Dupuy J, Volbeda A, Fontecilla Camps JC, Theil EC, Volz K title Structure of dual function iron regulatory protein 1 complexed with ferritin IRE RNA. journal Science volume 314 issue 5807 pages 1903 8 year 2006 pmid 17185597 doi 10.1126 science.1133116 ref Rfam box acc RF00037 description Iron responseelement abbreviation IRE avg length 29.30 avg identity 70.00 type Cis reg se Griffiths Jones SR ss Published PMID 8710843 release 10.0 The Iron responseelement or Iron responsive element IRE is a short conserved stem loop which is bound by Iron responsive element binding protein iron response proteins IRPs, also named IRE BP or IRBP . The IRE is found in Untranslated Region UTR s Untranslated Regions of various mRNA s whose products are involved in iron metabolism . For example, the mRNA of ferritin an iron storage protein contains one IRE in its 5 UTR . When iron concentration is low, IRPs bind the ferritin mRNA IRE leading to translation repression. Binding to multiple IREs in the Three prime untranslated region 3 UTR of the transferrin ... 2 External links Rfam id RF00037 name Iron responseelement http mrna.otago.ac.nz cgi bin tt data browse RNAMotif?PatID T0102 Transterm page for Iron Responsive Element DEFAULTSORT Iron ResponseElement Category Cis regulatory RNA elements molecular cell biology stub de Iron ResponseElement ... more details
Rfam box acc RF00036 description HIV Rev responseelement abbreviation RRE avg length 279.40 avg identity ... responseelement RRE, blue to mediate export of unspliced and singly spliced mRNA from the nucleus to the cytoplasm. The Rev responseelement RRE is a region in the RNA molecule of the HIV Env gene env ... Daugherty MD, Booth DS, Jayaraman B, Cheng Y, Frankel AD title HIV Rev responseelement RRE directs ... responseelement. journal Proc Natl Acad Sci U S A volume 107 issue 13 pages 5810 4 year 2010 pmid ... title Structure of the HIV 1 Rev responseelement alone and in complex with regulator of virion Rev ... switch in the HIV 1 Rev responseelement. journal Proc Natl Acad Sci U S A volume 105 ... N title Substitution of the Rev responseelement in an HIV 1 based gene delivery system with that of SIVmac239 ... arginine rich peptide with the HIV Rev responseelement RNA. journal J Pept Sci volume 14 issue ... that inhibit binding of alpha helical HIV 1 Rev protein to the rev responseelement RNA. journal Angew ... directed to the HIV 1 Rev responseelement. journal Bioorg Med Chem volume 15 issue 16 pages ... Targeted cleavage of HIV rev responseelement RNA by metallopeptide complexes. journal J Am Chem ... author Phuphuakrat A, Auewarakul P title Functional variability of Rev responseelement in HIV 1 primary ... P title Functional variation of HIV 1 Rev ResponseElement in a longitudinally studied cohort ... of aminoglycoside dimers and acridine conjugates to the HIV 1 Rev responseelement. journal Biochemistry ... author Phuphuakrat A, Auewarakul P title Heterogeneity of HIV 1 Rev responseelement. journal ... of HIV Rev Rev responseelement interaction identified by random screening. journal Antiviral Res ... RNA Rev responseelement. journal Nucleosides Nucleotides Nucleic Acids volume 19 issue 1 2 pages ... Real time kinetics of HIV 1 Rev Rev responseelement interactions. Definition of minimal binding ... MC, Wu JY, Maniatis T, Greene WC title HIV Rev dependent binding of SF2 ASF to the Rev responseelement ... more details
Rfam box acc RF00250 description Trans activation responseelement TAR abbreviation mir TAR avg length 60.00 avg identity 93.00 type Gene miRNA se PMID 12882959 ss Published PMID 12882959 release 10.0 The HIV trans activation response TAR element is an cis regulatory element RNA element which is known to be required for the trans activation of the viral promotor biology promoter and for virus replication. The TAR stem loop hairpin acts as a binding site for the Tat HIV Tat protein and this interaction stimulates the activity of the long terminal repeat promoter. ref cite journal last Kulinski first T coauthors Olejniczak M, Huthoff H, Bielecki L, Pachulska Wieczorek K, Das AT, Berkhout B, Adamiak RW year 2003 title The apical loop of the HIV 1 TAR RNA hairpin is stabilized by a cross loop base pair journal J Biol Chem volume 278 pages 38892 38901 pmid 12882959 doi 10.1074 jbc.M301939200 issue 40 ref Further analysis has shown that TAR is a microRNA pre microRNA that produces mature microRNAs from both strands of the TAR stem loop. ref name pmid18299284 cite journal author Ouellet DL, Plante I, Landry P, et al title Identification of functional microRNAs released through asymmetrical processing of HIV 1 TAR element journal Nucleic Acids Res. volume 36 issue 7 pages 2353 65 year 2008 month April pmid 18299284 pmc 2367715 doi 10.1093 nar gkn076 url http nar.oxfordjournals.org cgi pmidlookup?view long&pmid 18299284 ref These miRNAs are thought to prevent infected cells from under going apoptosis by down regulating the genes ERCC1 and IER3 . ref name pmid19220914 cite journal author Klase Z, Winograd R, Davis J, et al title HIV 1 TAR miRNA protects against apoptosis by altering cellular gene expression journal Retrovirology volume 6 issue pages 18 year 2009 pmid 19220914 pmc ... 1 External links Rfam id RF00250 name Trans activation responseelement TAR http microrna.sanger.ac.uk ... stub Category MicroRNA Category Cis regulatory RNA elements de Trans activation responseelement ... more details
Orphan date January 2010 Woodchuck hepatitis virus Woodchuck Hepatitis Virus WHP Posttranscriptional Regulatory Element WPRE is a DNA sequence that, when transcribed creates a tertiary structure enhancing gene expression expression . Commonly used in molecular biology to increase expression of gene s delivered by viral vector s ref Optimizing regulatable gene expression using adenoviral vectors. Lee YB, Glover CP, Cosgrave AS, Bienemann A, Uney JB. Exp Physiol. 2005 Jan 90 1 33 7. Epub 12 November 2004. Review. ref . The slightly variable sequence is 80bp long GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT ref Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element. Donello JE, Loeb JE, Hope TJ. J.Virol. 1998 Jun 72 6 5085 92 ref References references Genetics stub Category Gene expression Category DNA ... more details
in response to a hormonal signal, is the effective concentration of hormone receptor complexes ... pre or prohormone s. These can then be quickly converted into their active hormone form in response ... type hormone A hormone from Greek language Greek Polytonic impetus is a chemical released by a cell .... Only a small amount of hormone is required to alter cell metabolism . In essence, it is a chemical ... in the blood. Cells respond to a hormone when they gene expression express a specific receptor biochemistry receptor for that hormone. The hormone binds to the receptor protein , resulting .... endocrine system Endocrine hormone molecule s are secreted released directly into the bloodstream ... modern chemical compounds have hormone like effects on both humans and wildlife. Their Endocrine ... the following Citation needed date March 2010 Biosynthesis of a particular hormone in a particular tissue Storage and Cellular secretion secretion of the hormone Transport of the hormone to the target cell s Recognition of the hormone by an membrane protein associated cell membrane or intracellular ... a signal transduction process This then leads to a cellular response. The reaction of the target cells may then be recognized by the original hormone producing cells, leading to a down regulation in hormone ... of the hormone. Hormone cells are typically of a specialized cell type, residing within a particular ... with receptors Most hormones initiate a cellular response by initially combining with either ... protein. A cell may have several different receptors that recognize the same hormone and activate ... hormone s, the receptor is membrane associated and embedded in the plasma membrane at the surface of the cell. The interaction of hormone and receptor typically triggers a cascade of secondary effects ... protein hormone s also interact with intracellular receptors located in the cytoplasm or Cell nucleus nucleus by an intracrine mechanism. For hormones such as Steroid hormone steroid or Thyroid hormone ... more details
wiktionary Element may refer to Chemistry, electronics, or the geosciences Chemical element , a building block in chemistry Electrical element , an abstract part of a circuit Heating element , a device that generates heat by electrical resistance Weather , sometimes referred to as the elements Computing Adobe Photoshop Elements , a bitmap graphics program Adobe Premiere Elements , a video editing computer program Array data structure elements Data element , a unit of data HTML element , a standard part of a HTML document Law Element criminal law , a basic set of common law principles regarding criminal liability Mathematics Element mathematics , one of the constituents of a set Euclid s Elements Euclid s Elements , a mathematical treatise on geometry and number theory Music ELEMENT production team , a Norwegian production and songwriting team Elements Atheist album Elements Atheist album Elements band , 1980s 90s American jazz ensemble Elements Roger Glover album Elements Roger Glover album Elements Steve Howe album Elements Steve Howe album Elements, Pt. 1 , an album by Stratovarius ... element s, part of a traditional belief system Five elements Japanese philosophy , the basis ... , the basis of the universe according to Chinese Taoism Other Element by Westin, a brand of Starwood Hotels & Resorts Worldwide Element by Westin Starwood Hotels & Resorts Worldwide Element Skateboards , a skateboard manufacturer Elements, Hong Kong , a shopping mall in Hong Kong Honda Element , a sport utility vehicle Ola Moum , also known as elemeNt , a Norwegian professional gamer The elements ... disambig ca Element cs Element cy Elfen de Element et Element es Elemento eo Elemento eu Elementu fr l ment fur Element ga D il gv Elmint gl Elemento ko io Elemento id Unsur disambiguasi ... Elementas ms Unsur nl Element ja pap Elemento pl Element pt Elementos ro Element ru simple Element sk Element sl Element fi Elementti sv Element tl Elemento tt tg uk ... more details
Orphan date February 2009 Rfam box acc RF00490 description S element abbreviation S element avg length 66.40 avg identity 72.00 type Cis reg se PMID 15554980 ss Published PMID 15554980 release 10.0 The S element is an cis regulatory element RNA element found in p42d and related plasmid s. The S element has multiple functions and is believed to act as a negative regulator of repC Transcription genetics transcription , and be required for efficient replication and act as a translation al enhancer of repC. ref cite journal last Venkova Canova first T coauthors Soberon NE, Ramirez Romero MA, Cevallos MA year 2004 title Two discrete elements are required for the replication of a repABC plasmid an antisense RNA and a stem loop structure journal Mol Microbiol volume 54 pages 1431&ndash 1444 pmid 15554980 doi 10.1111 j.1365 2958.2004.04366.x issue 5 ref References reflist 1 External links Rfam id RF00490 name S element Category Cis regulatory RNA elements molecular cell biology stub ... more details
wiktionarypar response respond rejoinder Response may refer to Response liturgy , a line answering a versicle Response music or antiphon, a response to a psalm or other part of a religious service Output or response, the result of telecommunications input Response, a phase in emergency management The second half of the stimulus stimulus response relationship in psychology See also Response variable or realization thereof Answer Reply Transient response Steady state response Stimulus response model in statistics disambig de Response es Respuesta ja zh ... more details
Infobox Album See Wikipedia WikiProject Albums Name In Response Type studio Artist This Day Forward Commented out because image was deleted Cover TDF IR.jpg Released June 17, 2003 Recorded Dec 2002 Feb 2003 Genre Post Hardcore Length Label Equal Vision Records Producer Reviews Allmusic Rating 3 5 Allmusic class album id r644881 pure url yes link Last album Kairos EP br 2002 This album In Response br 2003 Next album In Response is the final studio album by Philadelphia post hardcore band This Day Forward . Track listing White Picket Defense System 3 22 Composed by Frangicetto, This Day Forward One and One 4 01 Composed by Frangicetto, This Day Forward The Breath 4 36 Composed by Frangicetto, Shaw, This Day Forward In the Past ... On the Ground 4 13 Composed by Frangicetto, Shaw, This Day Forward Euphio Question 2 18 Composed by Shaw, This Day Forward Fragile Version 4 18 Composed by Frangicetto, This Day Forward The Red Room 2 16 Composed by Shaw, This Day Forward Abandon the Abbreviated World 3 42 Composed by Frangicetto, Shaw, This Day Forward Nouveau 4 18 Composed by Frangicetto, This Day Forward Voice 5 09 Composed by Frangicetto, Shaw, This Day Forward Seven 3 51 Composed by This Day Forward Performed by Vadim Taver Musicians who played on the album Brendan Ekstrom Guitar Colin Frangicetto Drums Gary Shaw Bass Mike Shaw Vocals Vadim Taver Guitar, Wurlitzer, Vocals Category 2003 albums Category This Day Forward albums Category Equal Vision Records albums ... more details
subunits to translocate to the nucleus and phosphorylate the transcription factor cAMP responseelement ... protein CBP enhances the transcription of GH by binding to CREs cAMP responseelement s in the promoter ... Growth hormone releasing hormone receptor The GHRHR is a member of the secretin family of G protein ... in vesicle fusion and release of secretory vesicles containing premade growth hormone. ref name ... of GRH and somatostatin The actions of GHRH are opposed by growth hormone inhibiting hormone , more ... ar bg de Somatoliberin es Somatocrinina fr Hormone de lib ration de l hormone de croissance hr Somatokrinin id Somatokrinin it GHRH mk ... more details
regulating element for caste juvenile hormone titer in honey bee larvae Apis mellifera carnica ... s, JH also neotenin refers to a group of hormone s, which ensure growth of the larva , while preventing ... hormone JH III. To date JH 0, JH I, and JH II have been identified only in the Lepidoptera butterflies ... V.C., Gilbert L.I. 1989 Juvenile Hormone Bisepoxide Biosynthesis in vitro by the Ring Gland of Drosophila melanogaster A Putative Juvenile Hormone in the Higher Diptera. Proc Natl Acad Sci USA ..., which is juvenile hormone III lacking the epoxide group. ref Laufer, H, Borst, D, Baker, FC, Carasco, C, Sinkus, M, Reuter, CC, Tsai, LW, and Schooley, DA. 1987 Identification of a juvenile hormone ... hormones in honey bee s There is a complex interaction between JH, the hormone ecdysone and vitellogenin ..., G. E. 2001 . Juvenile hormone levels in honey bee Apis mellifera L. foragers foraging experience and diurnal .... ref Pearce A.N., Huang Z.Y., Breed M.D. 2001 Juvenile hormone and aggression in honey bees, Journal ... juvenilehormone.html Juvenile Hormone ref Although, JH does not activate foraging. Rather it is involved ..., O., Fahrbach, S. E. and Robinson, G. E. 2000 . Juvenile hormone paces behavioral development in the adult ... cgi reprint 104 17 7128 Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee ... sub O sub 2 sub Juvenile hormone 0 found in Lepidoptera Chemical Abstracts Service CAS methyl 2E,6E ... sub Juvenile hormone I found in Lepidoptera Chemical Abstracts Service CAS methyl 2E,6E 10R,11S oxiranyl ... hormone II found in Lepidoptera Chemical Abstracts Service CAS methyl 2E,6E 10R,11S oxiranyl 3,7,11 ... pesticides juvenile 20hormone 20iii.html Juvenile hormone III Chemical Abstracts Service CAS methyl ... http scienceblogs.com moleculeoftheday 2007 03 juvenile hormone epoxides not.php Juvenile hormone ... analogues of the juvenile hormone are used as an insecticide , preventing the larvae from developing ... by the WHO for use in drinking water cistern s to control mosquito larvae. Juvenile hormone ... more details
distinguish Release factor A releasing hormone or releasing factor is a hormone whose main purpose is to control the release of another hormone. The main releasing hormones secreted by the hypothalamus are Thyrotropin releasing hormone TRH , Corticotropin releasing hormone CRH , Gonadotropin releasing hormone GnRH , Growth hormone releasing hormone GHRH , Two other factors are also classed as releasing hormones, although they in fact inhibit pituitary hormone release Somatostatin , Dopamine . For example, TRH is released from the hypothalamus in response to low levels of secretion of thyroid stimulating hormone TSH from the pituitary gland . The TSH in turn is under feedback control by the thyroid hormones Thyroxine T4 and Triiodothyronine T3 . When the levels of TSH are too high, they feed back on the brain to shut down the secretion of TRH. Synthetic TRH is also used by physicians as a test of TSH reserve in the pituitary gland as it should stimulate the release of TSH and prolactin from this gland. Releasing hormones are sometimes known as liberins. For example, TRH may be known as thyroliberin. Inhibiting hormones may be known as statins. For example, dopamine which inhibits prolactin release may be called prolactostatin. Mechanism Releasing hormones increase or, in case of inhibitory factors, decrease the intracellular concentration of calcium Ca sup 2 sup , resulting in vesicle fusion of the respective primary hormone. For GnRH, TRH and GHRH the increase in Ca sup 2 sup is achieved by the releasing hormone coupling and activating G protein coupled receptors coupled to the Gq alpha subunit G sub q sub alpha subunit , activating the IP3 DAG pathway to increase Ca sup 2 ... and Medicine in 1977 for their contributions to understanding the peptide hormone production ... 11 Fulltext . DOI 10.1677 joe.1.05883 PMID 15642779. ref See also Hormone Neuroendocrinology References reflist Category Hormones Category Neuroendocrinology ar de Releasing Hormone he ... more details
A hormone receptor is a receptor protein on the surface of a cell or in its interior that binds to a specific hormone . The hormone causes many changes to take place in the cell. Binding of hormones to hormone receptors often trigger the start of a biophysical signal that can lead to further signal transduction pathway s, or trigger the activation or inhibition of genes. ref http www.bio balance.com Graphics.htm http www.bio balance.com Bot generated title ref Types of Hormone Receptors Peptide hormone receptors are often transmembrane protein s. They are also called G protein coupled receptor s, sensory receptor s or ionotropic receptor s. These receptors generally function via intracellular second messengers , including cyclic AMP cAMP , inositol 1,4,5 trisphosphate Inositol triphosphate IP3 and the Calcium signaling calcium Ca sup 2 sup calmodulin system. Steroid hormone receptor s and related receptors are generally soluble proteins that function through gene activation. Their response elements are DNA sequences promoters that are bound by the complex of the steroid bound to its receptor. The receptors themselves are zinc finger proteins. ref http users.rcn.com jkimball.ma.ultranet BiologyPages S SteroidREs.html Steroid Hormone Receptors and their Response Elements ref These receptors include those for Glucocorticoid glucocorticoids , estrogen s, androgen s, thyroid hormone T3 , calcitriol the active form of vitamin D , and the retinoid s vitamin A . References reflist Neuropeptide receptors Transcription factors g2 membrane protein stub receptor stub Category Receptors Category Endocrine system Category Integral membrane proteins de Hormonrezeptor it Recettori ormonali ... more details
secretory Vesicle biology vesicles , which can be secreted from the cell by exocytosis in response ... books?id QmNrJgAACAAJ&dq peptide hormone Peptide Hormone Secretion A Practical Approach, J. C ... amino acid residues that were needed to direct Folding chemistry folding of the hormone molecule into its active configuration but have no function once the hormone folds. Specific endopeptidase ... system bloodstream , generating the mature hormone form of the molecule. Mature peptide hormones then diffuse ... biochemistry receptors on the surface of their target cells. Some peptide protein hormone s angiotensin angiotensin II , basic fibroblast growth factor 2, parathyroid hormone related protein also ... secretes prolactin , which acts on the mammary gland , adrenocorticotrophic hormone ACTH , which acts on the adrenal cortex to regulate the secretion of glucocorticoids , and growth hormone , which acts on bone , muscle , and the liver . The posterior pituitary gland secretes antidiuretic hormone ... system in addition to acting as hormones when released into the blood. When a peptide hormone binds ... Category Peptide hormones de Proteohormone es Hormona pept dica fr Hormone peptidique nl Peptidehormoon ... more details
Orphan date February 2009 Prothoracicotropic hormone PTTH was the first insect hormone that was discovered. Originally described simply as brain hormone , early workers such as Kope 1922 ref Kope , S. 1922. Studies on the necessity of the brain for the inception of insect metamorphosis. Biol. Bull. 36 459 466. ref , and Wigglesworth 1934 ref Wigglesworth, V.B. 1934. The physiology of ecdysis in Rhodnius prolixus Hemiptera . II Factors controlling moulting and metamorphosis. Quart. J. Microsc. Sci. 77 191 223. ref realized that ligation of the head of immature insects could prevent molting or pupation of the body region excluded from the head if the ligation was performed before a critical age in the lifestage was reached. After a certain point the ligation had no effect and both sections of the insect would molt or pupate. However, implantation of a conspecific brain to a sessile ligated abdomen or an abdomen under diapause ref Williams, C.M. 1947. Physiology of insect diapause. II. Interaction between the pupal brain and prothoracic glands in the metamorphosis of the giant silkworm Platysamia cecropia . Biol. Bull. 92 89 180. ref would induce molting or pupation. Thus, the brain was originally thought to be the source of the hormone that induces molting in insects. Later it was established that the insect brain produces a number of hormones, but the hormone which was the cause of the observations made by Kope and Wigglesworth was prothoraciotropic hormone . PTTH is secreted by a neurohemal organ, the corpus cardiacum in some insects the corpus allatum secretes PTTH which is actually a discrete structure posterior to the brain. PTTH is released in response to environmental stimuli and as its name implies PTTH acts on the prothoracic glands , which respond by releasing molting hormone an ecdysteroid into the haemolymph . Molting hormone stimulates the molting process ref Chapman, R.F. 1998. The Insects Structure and Function. 4 sup th sup edition, Cambridge University ... more details
For the use of hormone antagonists in cancer , see hormonal therapy oncology A Hormone antagonist is a specific type of receptor antagonist which acts upon hormone s. External links MeshName Hormone antagonists Hormone antagonists biochemistry stub Category Hormonal agents Category Receptor antagonists ... more details
Hormone may refer to HormoneHormone is also the NATO reporting name for the Soviet Russian Kamov Ka 25 military helicopter. Hormones 2008 film Hormones , a 2008 Thai film. disambig ... more details
A hormone imbalance is when there is too little or too much of a particular hormone in one s body. Hormones are the chemical messengers in the body that travel the bloodstream to the organ anatomy organs ... in the testicle testes while women s are produced in the ovary ovaries . If hormone imbalance ... treatment of a growth hormone. It is possible that the imbalance could also cause an overproduction ... 6,000 endocrine system endocrine disorders that result because of hormone imbalance. An imbalance ... hormone that causes these changes is estrogen . Estrogen and progesterone A hormonal imbalance ... a woman s body. Estrogen is naturally produced by the ovaries and is the female hormone necessary for normal ... their production of estrogen and progesterone, causing symptoms of hormone imbalance to develop. Estrogen replacement therapy is a common treatment for hormone imbalance. Frequently, only estrogen is replaced .... Causes There are multiple causes for hormone imbalance, but the majority of cases are experienced ... . Of all of these causes, obesity is the number one medical cause for hormone imbalance while pregnancy ... experienced during hormone imbalance are shared by male and female, while some are more specific to each ... become more severe then we run into actual hormone allergy where we find a group of more serious disorders. ref http www.onlineallergycenter.com treatments hormone imbalance.htm Hormonal Imbalance ... sleep patterns or insomnia, and changes in sexual response. There is no need for prevention of menopause ... are recommended. Treatment for hormone imbalance It is important to understand all the risks and benefits of hormone replacement therapy HRT . Patients with a history of active or past breast cancer ... symptoms of the person experiencing hormone imbalance. Diet and exercise have also been proven effective .... Improper use of hormones A dangerous or fatal hormone imbalance can occur in those who use anabolic ... in a hormone imbalance that causes an increase in aggressive behavior, mood swings, or developmental ... more details
anterior lobe or adenohypophysis of the pituitary gland in response to the hormone corticotropin releasing hormone CRH released by the hypothalamus . ref cite web title Adrenocorticotropic Hormone ACTH ...protein Name proopiomelanocortin adrenocorticotropin beta lipotropin alpha melanocyte stimulating hormone beta melanocyte stimulating hormone beta endorphin caption POMC image width HGNCid 9201 Symbol POMC AltSymbols EntrezGene 5443 OMIM 176830 RefSeq NM 000939 UniProt P01189 PDB ECnumber Chromosome 2 Arm p Band 23 LocusSupplementaryData Adrenocorticotropic hormone ACTH , also known as corticotropin , Adrenocorticotrophic hormone , is a Peptide polypeptide tropic hormone produced and secreted by the Anterior pituitary anterior pituitary gland . It is an important component of the hypothalamic pituitary adrenal axis and is often produced in response to biological stress along with corticotropin releasing hormone from the hypothalamus . Its principal effects are increased production and release of corticosteroids and, as its name suggests, cortisol from the adrenal cortex . Production and regulation ACTH is synthesized from pre pro opiomelanocortin pre POMC . The removal of the signal peptide during translation produces the 267 amino acid polypeptide POMC, which undergoes a series of post translational modifications such as phosphorylation and glycosylation before it is proteolytically cleaved by endopeptidases to yield various polypeptide fragments with varying physiological activity. These fragments include ACTH, lipotropin, lipotropin, Melanocyte Stimulating Hormone MSH and ... stimulating hormone MSH . This common structure is responsible for hyperpigmentation excessively ... stimulating hormone MSH and CLIP, a peptide with unknown activity in humans. Human ACTH has a molecular ... adrenocorticotropic hormone green at left among the hormones with smallest concentration in the blood ... es Hormona adrenocorticotropa eu Hormona adrenokortikotropiko fr Hormone ... more details
Unreferenced stub auto yes date December 2009 Hormone therapy , or hormonal therapy is the use of hormones in medical treatment. Treatment with hormone antagonist s may also referred to as hormonal therapy . Wikipedia has the following articles regarding this topic Cancer Hormonal therapy oncology Hormonal therapy for cancer . Hormone therapy for prostate cancer refers to androgen deprivation therapy . Aging Hormone replacement therapy menopause connected to menopause Testosterone replacement in males with low levels due to disease or aging Sex reassignment Hormone replacement therapy female to male in sex reassignment therapy for trans men Hormone replacement therapy male to female in sex reassignment therapy for trans women Intersex conditions Hormone therapy in Klinefelter s syndrome Hormone therapy in Turner syndrome Hormonal deficiency Growth hormone treatment for growth hormone deficiency Thyroid hormone replacement in hypothyroidism Psychological treatment Chemical castration of violent sex offender s DEFAULTSORT Hormone Therapy Category Medical treatments Treatment stub systemic hormonal drug stub de Hormontherapie fr Hormonoth rapie it Terapia ormonale he nl Hormoonbehandeling ja pl Hormonoterapia pt Terapia hormonal fi Hormonihoito ... more details
Adipokinetic hormone Akh is a short peptide hormone that has been studied in insect s. It is a lipid mobilising hormone and is responsible for regulating fuel transport in the haemolymph , for redirecting energy to other processes as required by the insect. Akh was initially discovered in the desert locust Schistocerca gregaria and is generally associated with aiding flight ref Kaufmann, C. and M. Brown, Adipokinetic hormones in the African malaria mosquito, Anopheles gambiae Identification and expression of genes for two peptides and a putative receptor. Insect Biochemistry and Molecular Biology, 2006. 36 6 p. 466 481 ref . Early observations of locust s showed that despite the fact that lipids are metabolised by flight muscle in order to maintain flight, which would be transported from the haemolymph, there was often still a high concentration of lipids in the haemolymph, implying that an agent may be responsible for activating lipid transport into the haemolymph and this was thought most likely to be hormonal regulation . ref name Chapter Eleven http entomology.unl.edu ent801 xport.html Chapter Eleven Bot generated title ref Akh was first purified by an English group in 1976 and the chemical structure was determined to be a peptide hormone formed from 10 amino acids . This was the first instance where an insect peptide hormone had been identified. ref name Chapter Eleven Later, after Akh hormones were identified in cockroach es, locust Akh was inserted into a cockroach and a similar ... Goldsworthy, G.J., K. Opoku Ware, and L.M. Mullen, Adipokinetic hormone and the immune responses ... Goldsworthy, G. 2002. p. 601 608 Goldsworthy, G., K. Opoku Ware, and L. Mullen, Adipokinetic hormone ... immune response than locusts which only received an LPS injection ref name Goldsworthy, G. 2002. p .... Journal of Experimental Biology, 2001. 204 16 p. 2773 80. ref . Stimulation of the immune response ... Hormone Category Insect hormones ... more details
4 sub and triiodothyronine T sub 3 sub , are tyrosine based hormone s produced by the thyroid gland ... hormones is iodine . The major form of thyroid hormone in the blood is thyroxine T sub 4 sub , which ... T sub 0 sub a . Circulation and Transport Plasma transport Most of the thyroid hormone circulating in the blood is bound to transport protein s. Only a very small fraction of the circulating hormone ... is of great diagnostic value. When thyroid hormone is bound, it is not active, so the amount of free ..., the thyroid hormone receptor s. T sub 1 sub a and T sub 0 sub a are positively charged and do ... tool is measurement of the amount of thyroid stimulating hormone TSH that is present. Membrane transport ... , affect protein synthesis , help regulate long bone growth synergy with growth hormone , neuronal maturation ... metabolism. Numerous physiological and pathological stimuli influence thyroid hormone synthesis. Thyroid hormone leads to heat generation in humans. However, the thyronamines function via some unknown ... by thyroid hormone uptake , which, in turn, is a measure of the unbound thyroxine binding ... hormones Both T sub 3 sub and T sub 4 sub are used to treat thyroid hormone deficiency hypothyroidism ... in industrialized countries are treated with levothyroxine, or a similar synthetic thyroid hormone ... http www.medicinenet.com levothyroxine sodium article.htm preferred thyroid hormone Levothyroxine ... ref . However, Desiccated thyroid extract natural thyroid hormone supplements from the dried thyroids ... pubmed 11786691 Thyroid hormone replacement therapy ref For these people, there is synthetic T3 ... These patients may also choose to take natural thyroid hormone, as it contains a mixture of T4 and T3 ... on 2009 3 27 ref . Some natural thyroid hormone brands are F.D.A. approved, but some are not ref name ... hormone. ref name medicinenet levothyroxine . One exception is that thyroid hormones may aggravate ... hormone TSH made by the Thyrotrope thyrotrophs of the anterior pituitary gland. Because the effects ... more details
affect the anabolic response to parathyroid hormone? journal Trends Endocrinol. Metab. volume 15 ...PBB geneid 5741 Parathyroid hormone PTH , parathormone or parathyrin , is secreted by the parathyroid ... Ca sup 2 sup in the blood , whereas calcitonin a hormone produced by the parafollicular cells C cells ... of calcium in the blood by acting upon parathyroid hormone receptor in three parts of the body ... cite journal author Bieglmayer C, Prager G, Niederle B title Kinetic analyses of parathyroid hormone ... Prahalad AK, Hickey RJ, Huang J, et al. title Serum proteome profiles identifies parathyroid hormone physiologic response journal Proteomics volume 6 issue 12 pages 3482 93 year 2006 month June pmid ... structure of human parathyroid hormone 1 34 at 0.9 A resolution journal J. Biol. Chem. volume 275 issue ... The N terminus N terminal fragment 1 34 of parathyroid hormone PTH has been crystallized and the structure ... of serum calcium Parathyroid hormone regulates serum calcium through its effects on the following ... K, Reeve J title Parathyroid hormone a bone anabolic and catabolic agent journal Curr Opin Pharmacol ... 3 oclc doi ref The role of parathyroid hormone is shown in blue. PTH was one of the first hormones ... D. Regulation of PTH secretion Secretion of parathyroid hormone is controlled chiefly by blood plasma ... Parathyroid hormone family Calcium metabolism Disorders of calcium metabolism Parathyroid hormone ... journal author Dr eke TB, Massy ZA title Advanced oxidation protein products, parathyroid hormone and vascular ... 12207101 doi 10.1159 000065203 cite journal author Parfitt AM title Parathyroid hormone and periosteal ... HT, Sauer MM, Hendy GN, et al. title Complete amino acid sequence of human parathyroid hormone journal ... terminal sequence of human parathyroid hormone journal Biochemistry volume 14 issue 9 pages 1842 7 ... splice site mutation in the parathyroid hormone gene is associated with autosomal recessive hypoparathyroidism ... hormone gene in lymphocytes, lymphoblastoid cells and tumour tissue journal J. Endocrinol. volume ... more details
Encyclopedia
top
