Encyclopedia results for Adenine

1. Adenine
   
   for the programming language Adenine Adenine programming language chembox verifiedrevid 321785276 ImageFile1 Adenine chemical structure.png ImageSize1 150px ImageFileL2 Adenine 3D balls.png ImageSizeL2 ..
   
   
   
   
2. Adenine deaminase
   
   enzyme Name adenine deaminase EC number 3.5.4.2 CAS number 9027 68 3 IUBMB EC number 3 5 4 2 GO code 0000034 image width caption In enzymology , an adenine deaminase EC number 3.5.4.2 is an enzyme that catalysis ..
   
   
   
   
3. Adenine phosphoribosyltransferase
   
   PBB geneid 353 Adenine phosphoribosyltransferase is an enzyme that in humans is encoded by the APRT gene . ref name entrez cite web title Entrez Gene APRT adenine phosphoribosyltransferase url http www.ncbi.nlm.nih.gov ..
   
   
   
   
4. File:Adenine-structure.png
   
   Adenine from ChemDraw STD 8.0 GFDL en migration relicense ..
   
   
   
   
5. Adenine (programming language)
   
   for the nucleic base Adenine Adenine Adenine , named after the nucleic acid adenine , is a script language ... characteristic of Adenine is that this language possesses native support for the Resource Description ..
   
   
   
   
6. Adenine nucleotide translocator
   
   FixBunching beg protein Name solute carrier family 25 mitochondrial carrier adenine nucleotide translocator ... FixBunching mid protein Name solute carrier family 25 mitochondrial carrier adenine ..
   
   
   
   
7. Adenine phosphoribosyltransferase deficiency
   
   Infobox Disease Name Adenine phosphoribosyltransferase deficiency Image Dihydroxyadenine.png Caption ... 102600 MedlinePlus eMedicineSubj eMedicineTopic MeshName MeshNumber Adenine phosphoribosyltransferase ..
   
   
   
   
8. Nicotinamide adenine dinucleotide phosphate
   
   MainHazards FlashPt Autoignition Nicotinamide adenine dinucleotide phosphate NADP sup sup , in older ... the adenine moiety. In plants In chloroplast s, NADP sup sup is reduced by ferredoxin NADP sup ..
   
   
   
   
9. Nicotinamide adenine dinucleotide
   
   NFPA H 1 NFPA F 1 NFPA R 0 FlashPt Autoignition Nicotinamide adenine dinucleotide , abbreviated ... containing an adenine base and the other containing nicotinamide . In metabolism , NAD sup sup is involved ..
   
   
   
   
10. Nicotinic acid adenine dinucleotide phosphate
    
    Solubility Section14 Chembox Hazards MainHazards FlashPt Autoignition Nicotinic acid adenine dinucleotide ..
    
    
    
    
11. Phosphoribosyltransferase
    
    A phosphoribosyltransferase is a type of transferase enzyme. Types include Adenine phosphoribosyltransferase Hypoxanthine guanine phosphoribosyltransferase Orotidine 5 phosphate decarboxylase Uracil phosphoribosyltransferase ..
    
    
    
    
12. Nitrogenous base
    
    , the nucleobase s building blocks of DNA and RNA adenine , guanine , thymine , cytosine , and uracil . Adenine and thymine guanine and cytosine are complementary to each other. Adenine pairs only with thymine ..
    
    
    
    
13. File:XA-T DNA base pair.svg
    
    Summary Information Description extended adenine thymine pair Source self made Date . Location . Author User Squidonius Squidonius User talk Squidonius talk other versions Licensing PD self date April ..
    
    
    
    
14. Pentosyltransferases
    
    Pentosyltransferases are a type of glycosyltransferase that catalyze the transfer of a pentose . Examples include adenine phosphoribosyltransferase hypoxanthine guanine phosphoribosyltransferase pertu ...
    
    
    
    
15. Repeat induced point-mutation
    
    Unreferenced date January 2007 Orphan date February 2009 In molecular biology , repeat induced point mutation or RIP is a process by which DNA in Neurospora crassa accumulates Guanine G Cytosine C to ...
    
    
    
    
16. Purine imidazole-ring cyclase
    
    math rightleftharpoons math DNA adenine H sub 2 sub O Hence, this enzyme has one substrate biochemistry ... adenine and water H sub 2 sub O . This enzyme belongs to the family of lyase s, specifically amidine ..
    
    
    
    
17. Discadenine synthase
    
    sub isopentenyl adenine math rightleftharpoons math 5 methylthioadenosine discadenine Thus, the two ... adenine , whereas its two product chemistry products are 5 methylthioadenosine and discadenine . This enzyme ..
    
    
    
    
18. List of Y-DNA single-nucleotide polymorphisms
    
    Forward 5 3 Reverse 5 3 M1 YAP 291bp insertion M2 Adenine A to Guanine G 168 209 aggcactggtcagaatgaag ... M203 M207 M213 M214 M216 M217 M231 Guanine G to Adenine A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg ..
    
    
    
    
19. Methylase
    
    and adenine adenine residues in DNA . See also Demethylase References references transferase stub ..
    
    
    
    
20. File:Mupirocin Cluster chart.png
    
    , NADH Nicotinamide adenine dinucleotide reduced , NADPH Nicotinamide adenine dinucleotide phosphate ..
    
    
    
    
21. Mannuronate reductase
    
    , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 4 product chemistry products are D mannuronate , nicotinamide adenine ..
    
    
    
    
22. 21-hydroxysteroid dehydrogenase (NADP+)
    
    substrates of this enzyme are pregnan 21 ol and nicotinamide adenine dinucleotide phosphate NADP sup sup , whereas its 3 product chemistry products are pregnan 21 al , nicotinamide adenine dinucleotide ..
    
    
    
    
23. Rubredoxin-NAD(P)+ reductase
    
    rubredoxin , nicotinamide adenine dinucleotide NAD sup sup , and nicotinamide adenine dinucleotide ... , nicotinamide adenine dinucleotide NADH , nicotinamide adenine dinucleotide phosphate NADPH , and hydrogen ..
    
    
    
    
24. ATP-dependent NAD(P)H-hydrate dehydratase
    
    1,4,5,6 tetrahydronicotinamide adenine dinucleotide math rightleftharpoons math ADP phosphate ... hydroxy 1,4,5,6 tetrahydronicotinamide adenine , and dinucleotide , whereas its 3 product chemistry ..
    
    
    
    
25. FAD diphosphatase
    
    . Other names in common use include FAD pyrophosphatase , riboflavin adenine dinucleotide pyrophosphatase , flavin adenine dinucleotide pyrophosphatase , riboflavine adenine dinucleotide pyrophosphatase ..
    
    
    
    

Articles 1 - 25 of 1131          Next

Search   in   Tutorials Encyclopedia Dictionary Directory

Search for Adenine in Tutorials

Search for Adenine in Encyclopedia

Search for Adenine in Dictionary

Search for Adenine in Open Directory

Search for Adenine in Store

Search for Adenine in PriceGig

Help build the largest human-edited directory on the web. Submit a Site - Open Directory Project - Become an Editor