Search: in
Haplogroup R1b (Y-DNA)
Haplogroup R1b (Y-DNA) Encyclopedia
  Tutorials     Encyclopedia     Dictionary     Directory  
Haplogroup_R1b_(Y-DNA) Email this to a friend      Haplogroup_R1b_(Y-DNA)

Haplogroup R1b (Y-DNA)

Distribution of R1a (purple) and R1b (red).
Distribution of R1a (purple) and R1b (red).
In human genetics, Haplogroup R1b is the most frequent Y-chromosome haplogroup in Western Europe.

Its frequency is highest in Western Europe, especially in Atlantic Europe (and due to European emigration, in North America, South America, and Australia). In southern England, the frequency of R1b is about 70%, and in parts of north and western England, Spain, Portugal, France, Wales, Scotland and Ireland, the frequency of R1b is greater than 90%. It is also found in North Africa where its frequency surpasses 10% in some parts of Algeria[1].

R1b is also current in many different populations at Ural and Central Asia.

Haplogroup R1b is defined by the presence of single nucleotide polymorphism (SNP) M343, which was discovered in 2004.[2] From 2002 to 2005, R1b was defined by the presence of SNP P25; prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as Hg1 and Eu18.[3]

Contents


Origins

TMRCA for Y chromosome haplogroups (Karafet et. al (2008))
TMRCA for Y chromosome haplogroups (Karafet et. al (2008))

I. Dupandunlop argued in 2002[4] that Basque genes and hence haplogroup R1b1b2 (R1b1c) were the most representative of Paleolithic European population. In this she followed previous research done fundamentally on mitochondrial DNA. Many other authors have followed her conclusions for further research, assuming thereafter that R1b1b2 (R1b1c) is of Paleolithic origin.

Based on R1b frequency and variability, most researchers considered the genetic pool of western European countries - Belgium, France, Germany, Ireland, the Netherlands, north Italy, Portugal, Spain and United Kingdom - to date back to Paleolithic times, noticing the overlap between R1b previously estimated age (about 25,000 to 30,000 years ago) and the European Upper Paleolithic. The hypothesis met apparent confirmation in the fact that the Basques, who traditionally have been considered descendants of the European Paleolithic strata, have one of the highest frequencies of R1b in the world.

However, linguistic-historical studies performed by paleo-Hispanists, and also some genetic research[5], the latter focusing on the lower R1b1b2 (R1b1c) diversity among Basques, disputed either their assumed remote Hispanic origins or their position as the group who has best conserved their Paleolithic European genetic ancestry, and deny Basque territory represents a mayor focus of expansion:

According to the most recent information, the high R1b frequency region of northern France, Belgium and the southern Netherlands show peak values of R1b diversity. To a lesser degree, also northwestern Spain show a peak value. Other diversity peaks occur in low frequency areas: especially northern Croatia, possibly caused by enhancements due to migrations.[6]

By 2008, T. Karefet et al., based on the latest discoveries on polymorphisms, rearranged the human paternal phylogenetic tree by adding one new haplogroup and altering some of the estimated ages of previously known haplogroups, including the parent haplogroup to R1b, R1, now considered to have originated 18,500 BP.[7].

Studies from Volga-Urals have revealed high frequencies of R1b1b2 in Eastern European populations such as Bashkirs, indicating their closeness with West European populations. Observed low genetic diversity here has been explained by a founder effect.[8]

Subclades

R1b is a descendant of Haplogroup R1, which is defined by the presence of SNP marker M173. Subclades of R1b per ISOGG 2008 are listed below with their respective SNP markers in parentheses.

  • R1b (M343)
    • R1b*
    • R1b1 (P25)
      • R1b1*
      • R1b1a (M18)
      • R1b1b (P297) [9]
        • R1b1b1 (M73) (formerly R1b1b)
        • R1b1b2 (M269, S3, S10, S13, S17) (formerly R1b1c)[10]
          • R1b1b2*
          • R1b1b2a (S127, S128, S129)
            • R1b1b2a*
            • R1b1b2a1 (M405/S21/U106) (formerly R1b1c9)
              • R1b1b2a1*
              • R1b1b2a1a (M467/S29/U198) (formerly R1b1c9b)
              • R1b1b2a1b (P107)
              • R1b1b2a1c ([DYS439=null]/L1/S26) (formerly R1b1c9a)
            • R1b1b2a2 (S116/rs34276300)[10]
              • R1b1b2a2*
              • R1b1b2a2a (M37) (formerly R1b1c1)
              • R1b1b2a2b (M65) (formerly R1b1c2)
              • R1b1b2a2c (M153) (formerly R1b1c4)
              • R1b1b2a2d (M167/SRY2627) (formerly R1b1c6)
              • R1b1b2a2e (M222/USP9Y+3636) (formerly R1b1c7)
              • R1b1b2a2f (P66) (formerly R1b1c8)
              • R1b1b2a2g (S28/U152) (formerly R1b1c10)
                • R1b1b2a2g1 (M126) (formerly R1b1c3)[9]
                • R1b1b2a2g2 (M160) (formerly R1b1c5)[9]
              • R1b1b2a2h (S68) (formerly R1b1c11)
      • R1b1c (M335) (formerly R1b1d; location relative to P297 uncertain)

R1b1b2 (formerly R1b1c)

Most of the present-day European males with the M343 marker also have the P25 and M269 markers. These markers define the R1b1b2 subclade.

This subgroup is believed by some to have existed before the last Ice Age and has been associated with the Aurignacian culture[11] (32,000 - 21,000 BC). Although the precise route of the M269 marker is not known, it is theorized to have originated in Central Asia/South Central Siberia. Archeological evidence supports the view of the arrival of Aurignacian culture to Anatolia from Europe during the Upper Paleolithic rather than from the Iranian plateau[12]. It could have entered prehistoric Europe from the area of Ukraine/Belarus or Central Asia (Kazakhstan) via the coasts of the Black Sea and the Baltic Sea. It is considered widespread in Europe throughout the Paleolithic already before the last Ice Age.[13]

Traditionally this culture is associated with the Cro-Magnon people, the first modern humans to enter Europe. However, this view has recently been challenged.[14] The people of the Aurignacian culture were the first documented human artists, making sophisticated cave paintings. Famous sites include Lascaux in France, Altamira in Spain and Valley of Foz Côa in Portugal (the largest open-air site in Europe).

European LGM refuges, 20 kya.
European LGM refuges, 20 kya.
The glaciation of the ice age intensified, and the continent became increasingly uninhabitable. The genetic diversity narrowed through founder effects and population bottlenecks, as the population became limited to a few coastal refugia in Southern Europe. The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian Peninsula (Portugal and Spain), where the R1b1c haplogroup may have achieved genetic homogeneity. As conditions eased with the Allerød Oscillation in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from Iberia to Scandinavia, so evident in haplogroup maps.http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf

A second R1b1b2 population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying Y-STR markers, appear to have survived alongside other haplogroups in Eastern Europe. However, they do not have the same dominance that R1b has in Western Europe. Instead the most common haplogroup in Eastern Europe is haplogroup R1a1.

Note that haplogroup R1b and haplogroup R1a first existed at very different times. The mutations that characterize haplogroup R1b occurred ~30,000 years bp, whereas the mutations that characterize haplogroup R1a occurred ~10,000 years bp.

(In earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup. Then, for a time [from 2003 to 2005] what is now R1b1b2 was designated R1b3. From 2005 to 2008 it was R1b1c. This shows how nomenclature can evolve as new markers are discovered and then investigated).

R1b1b2a1

The R1b1b2a1 (formerly R1b1c9) subclade is defined by S21 (also U106 or M405) and appears to be about in over 25% of R1b. It was discovered by Gareth Henson and was quickly set up as a test offered by EthnoAncestry. This group has a maximum in Frisia (the Netherlands) and, in general, is the predominant R1b haplogroup. The S21 subclade may have originated towards the end of the last ice age, or perhaps more or less 7000 BC, possibly in the northern European mainland.http://www.geocities.com/mcewanjc/s21comment.htm A close match of the present ? day distribution of S21 and the territorial pattern of the Eastern Corded Ware cultures and the Single Grave cultures has been observed.[15]

In Europe, the subclade (including downstream S29) has a global distribution going north west to east and is found in higher concentrations in England (21.4%) and Scandinavia (Denmark 17.7%), reaches a maximum in the Netherlands (37.2%) and slopes down to the east through Germany (20.5%) and the Alps (Switzerland 13.3%, Austria 22.7%) towards the Czech Republic (13.9%) and Ukraine (9.4%). Towards North-Eastern Europe the concentration goes down to 8.2% in Poland and 7.2% in Russia. The subclade appears to be omnipresent in Europe, although it becomes less pronounced in Ireland (5.9%) and France (7.1%) and, further towards the Mediterranean, low values are measured in Italy (3.5%), the Balkan and Turkey.[16]

The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al (2007) http://www3.interscience.wiley.com/homepages/38515/pdf/940.pdf. Family Tree DNA started to test the U152 (equivalent to S28) and U106 (equivalent to S21) on 21 February 2008.

Downsteam of S21, the R1b1b2a1a subclade is defined by S29 (also U198 or M467). It was discovered by EthnoAncestry. Although attested in southern England and Germany in the region previously inhabited by the Saxons, it is unknown this marker arrived in England with the Anglo-Saxons in the 5th Century. Nothing but low values of the marker have been detected over a wide area, that besides England (1.4%) and Germany (1.8%) includes the Netherlands (maximum value 2.1%), Denmark (0.9%) and Russia (1.8%).[16]

Also downsteam of S21, the R1b1b2a1c subclade is defined by the L1/S26 SNP. It occurs in less than a half a percent of R1b males, mainly with roots in the south and east of England and in Germany. L1, first discovered by Family Tree DNA, then confirmed and named S26 by EthnoAncestry, is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "null439". FTDNA displays null alleles at DYS439 with a Blue 12 on public pages, and with a Blue asterisk beside 439 on personal results pages. Other testing companies do report detecting null 439s. For further information, see the null439 project at http://www.familytreedna.com/public/null439.

R1b1b2a2

The S116 (rs34276300) SNP is downstream of M269 and upstream of the M37, M65, M153, SRY2627 (M167), M222 and S28 SNPs, but not S21. It appears to divide R1b1b2 in half. Although unpublished it was included in chip-based commercial DNA tests towards the end of 2007 and analysis of the first available results in early 2008 by amateur geneticists indicated it has a significant place in the Y-DNA tree. This led to rapid development of stand-alone tests by both EthnoAncestry and Family Tree DNA. The results from customers of these companies and testing of control samples for the rarer SNPs have confirmed the status of S116 relative to the above list.

R1b1b2a2c (M153): This haplogroup has been found so far in 39 individuals, most of them Basques; the rest were likely of Iberian ancestry or have not been classified ethnically[17]. The first time it was located (Bosch 2001[18]) it was described as H102 and included 7 Basques and one Andalusian.

R1b1b2a2d (SRY2627 or M167): The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999[19]. He found it relatively common among Basques (13/117: 11%) and Catalans (7/32: 22%). Other occurrences were found among other Spanish, Béarnais, other French, British and Germans.

In 2000, Rosser[20] also tested for that same marker, naming the haplogroup Hg22, and again it was found mainly among Basques (19%), in lower frequencies among French (5%), Bavarians (3%), Spanish (2%), Southern Portuguese (2%), and in single occurrences among Romanians, Slovenians, Dutch, Belgians and English.

In 2001, Bosch[21] described this marker as H103, in 5 Basques and 5 Catalans. Further regional studies[22] have located it in significative amounts in Asturias, Cantabria and Galicia, as well as again among Basques. Cases in the Azores and Latin America have also been reported. A total of 85 individuals with this haplogroup have been found so far, almost all of them in academic studies, making it the best documented R1b1c subclade[23].

The subclade R1b1b2a2e (M222), on the other hand, is associated with the Irish and Scots; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern Ireland may be due to positive social selection, as R1b1b2e-M222 is believed to have been the Y-chromosome haplogroup of the kings of the Uí Néill clan of ancient Ireland.

The R1b1b2a2g (formerly R1b1c10) subclade is defined by S28 (also U152) and its discovery was announced in 2005 by EthnoAncestry. Although sample sizes are relatively small, it appears to reach a maximum in Alpine Germany and Switzerland. Ethnoancestry's commercial and research branches have shown that S28 is found from Greece westward to the Bay of Biscay in France. It appears to follow the distribution of the La Tene Celtic peoples. The percentages here are much less than found in the Alps. It has yet to be found anywhere in Ireland or Spain. Northern Italy seems to be a meeting place for both S21 and S28. Like S21, S28's specifications were not initially officially published by EthnoAncestry against their previous assertions that data would be publicly published; but again the marker was subsequently identified independently (as their "U152") by Sims et al (2007). http://www.geocities.com/mcewanjc/s28.htm

A recent Y-SNP to surface is S68 defining R1b1b2a2h which was reported by EthnoAncestry in 2007. It was originally considered to be what was once referred to as a "private SNP" and by EthnoAncestry as a "Family SNP", but was recently seen in someone from another part of Europe, and with a different surname. It is only with continued research that the time depth of these markers can be estimated. At present S68 has been seen in an individual from Scotland and another from Sweden. EthnoAncestry has determined that this subclade is unlikely to be found in much more than 2% of the R1b population and is thus not considered a polymorphism.

Other subclades

Besides the ubiquitous R1b1b2-M269, other subclades descended from haplogroup R1b1 have been identified, including R1b1b1 (M73), R1b1a (M18), and R1b1c (M335). Haplogroup R1b1b1-M73, which represents the closest patrilineal relatives of haplogroup R1b1b2-M269, has been found in SE Europe and SW Asia[24] and at generally low frequencies throughout central Eurasia. Haplogroup R1b1a-M18 has been found only at low frequencies in samples from Sardinia and Lebanon. Haplogroup R1b1c-M335 has been identified in Cameroon[24] and in a sample from Turkey.[25]

Though African haplogroup R chromosomes are generally quite rare, R-P25* (R1b1*) chromosomes are found at remarkably high frequencies in northern Cameroon (60.7?94.7%),[26] especially among the Ouldeme of Northern Cameroon in west central Africa, aging at least 4,100 years.[27] R1*-M173 are also observed in the Bantu of southern Cameroon (14.3%), Oman (10.7%), Egypt (6.8%), and the Hutu (1.4%). Whereas the R1*-M173 undifferentiated lineage is present in all four populations, the two downstream mutations, M17 (R1a1) and M269 (R1b1b2, formerly R1b1c or R1b3), are confined to Egypt and Oman. It is plausible that the African and Omani R1*-M173 chromosomes may be relics of an ancient back migration from Asia to Africa, which may have been a southern branch of an Upper Paleolithic westward expansion of this clade. The antiquity of the M173 backflow is implied by the total lack in sub-Saharan Africa of downstream mutations R1a1-M17 and R1b1b2-M269, associated with the post?Last Glacial Maximum (LGM) reinhabitation of Eurasia.[28]

Haplotypes

Modal

Recognizable instances of a modal haplotype have been noted within the R1b haplogroup.

One of the best-characterized of these haplotypes is the Atlantic Modal Haplotype (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and in Great Britain and Ireland. In the Iberian Peninsula it reaches 33% in Portugal while the highest value is to be found among Spanish Basques. This has additionally been referenced in literature as Haplotype 15.

Another haplotype of R1b, with DYS393=12, has been referenced in the literature as Haplotype 35, or ht35[29]. They can be found in high numbers in Southeastern Europe and Western Asia. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia during the Last Glacial Maximum instead of in Iberia. Descendants can be found in high numbers in the Armenian Highland and Armenia with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 in Uyghur populations in western China, which is theorized to be a remnant of the Tocharians, an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until later being absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, most likely with the arrival of Roman soldiers.

Niall of the Nine Hostages

In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with Niall of the Nine Hostages, an Irish king in the Dark Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1c7.

Mutation

The technical details of M343 (rs9786184) are:

Nucleotide change: C to A
Position (base pair): 402
Total size (base pairs): 424
Forward 5'? 3': tttaacctcctccagctctgca
Reverse 5'? 3': acccccacatatctccagg

This refers to a particular 424 base pair fragment of DNA that the polymerase chain reaction produces when one uses the two "primer" strands listed.

Popular culture

Bryan Sykes, in his book Blood of the Isles, gives the populations associated with R1b the name of Oisín for a clan patriarch, much as he did for mitochondrial haplogroups in The Seven Daughters of Eve. Stephen Oppenheimer also deals with this population group in his book Origins of the British.

See also

References

External links

Maps

Projects

cs:Haploskupina R1b (Y-DNA) lt:Haplogrup? R1b (Y chromosoma) pt:M343





Source: Wikipedia | The above article is available under the GNU FDL. | Edit this article



Related Links in Haplogroup R1b (Y-DNA)

Search for Haplogroup R1b (Y-DNA) in Tutorials
Search for Haplogroup R1b (Y-DNA) in Encyclopedia
Search for Haplogroup R1b (Y-DNA) in Dictionary
Search for Haplogroup R1b (Y-DNA) in Open Directory
Search for Haplogroup R1b (Y-DNA) in Store
Search for Haplogroup R1b (Y-DNA) in PriceGig


Help build the largest human-edited directory on the web.
Submit a Site - Open Directory Project - Become an Editor

Advertisement

Advertisement



Haplogroup R1b (Y-DNA)
Haplogroup_R1b_(Y-DNA) top Haplogroup_R1b_(Y-DNA)

Home - Add TutorGig to Your Site - Disclaimer

©2008-2009 TutorGig.com. All Rights Reserved. Privacy Statement