Search: in
Haplogroup Q (Y-DNA)
Haplogroup Q (Y-DNA) Encyclopedia
  Tutorials     Encyclopedia     Dictionary     Directory  
Haplogroup_Q_(Y-DNA) Email this to a friend      Haplogroup_Q_(Y-DNA)

Haplogroup Q (Y-DNA)

In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.

Haplogroup Q is a branch of haplogroup P (M45). It is believed to have arisen in Siberia approximately 15,000 to 20,000 years ago.

This haplogroup contains the patrilineal ancestors of many Siberians, Central Asians, and indigenous peoples of the Americas. Haplogroup Q Y-chromosomes are also found scattered at a low frequency throughout Eurasia.[1] This haplogroup is diverse despite its low frequency among most populations outside of Siberia or the Americas, and at least six primary subclades have been sampled and identified in modern populations.

Contents


Origins

A migration from Asia into Alaska across the Bering Strait was done by haplogroup Q populations approximately 15,000 years ago. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism (SNP).

Discovery of ancestral Q in the Indian subcontinent

A Biomed study observed an ancestral state Q* and a novel sub-branch Q5, not reported elsewhere, in Indian subcontinent, though in low frequency BMC Evol Biol. 2007; 7: 232. A novel subgroup Q4 was identified recently which is also restricted to Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to Indian subcontinent followed by an autochthonous differentiation to Q4 and Q5 sublineages later on. Thus the subcontinent has three novel Q lineages, an ancestral Q* (different from the Central Asian Q*), Q4 and Q5 unique to the subcontinent. However, the recent ISOGG tree lacks the representation of Q5 (defined by ss4 bp, rs41352448) BMC Evol Biol. 2007; 7: 232. Y-Haplogroup Q4 is shown as Q1a3 (defined by M346) in the recent ISOGG tree. Taking the relationship of Q4 (M346) and Q5 (ss4bp) into consideration BMC Evol Biol. 2007; 7: 232 Q5 may be positioned as Q1a7.

Technical specification of mutation

The technical details of M242 are:

Nucleotide change: C to T
Position (base pair): 180
Total size (base pairs): 366
Forward 5?? 3?: aactcttgataaaccgtgctg
Reverse 5?? 3?: tccaatctcaattcatgcctc

Distribution

In the Old World the Q lineage and its many branches is largely found within a huge triangle defined by Norway in the West, Iran in the South and Mongolia in the East. There is also a rough correlation between the Turkic-speaking peoples of Central Eurasia and Q. The frequency of Q in Norway and Mongolia is about 4% while in the Iranian cities of Shiraz and Esfahan, the frequency runs between 6% and 8%; Iranian samples of haplogroup Q belong almost exclusively to the M25 defined subclade. In the middle of this triangle, in Uzbekistan and Turkmenistan, the frequency of Q runs between 10% and 14%. Haplogroup Q is found in approximately 2% of males in Turkey and Lebanon.[2][3] Only two groups in the Old World are majority Q groups. These are the Selkups (~70%) and Kets (~95%). They live in western and middle Siberia and are small in number, being just under 5,000 and 1,500, respectively.

Subgroups

The subclades of Haplogroup Q with their defining mutation(s), according to the 2008 ISOGG tree are provided below. Subclade Q1a7 (ss4 bp, rs41352448) is not represented in ISOGG 2008 tree but has been found as a novel Q lineage (Q5) in indian populations http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2258157 BMC Evol Biol 2007. The 2008 ISOGG tree, along with Q5(ss4 bp, rs41352448) that may be represented as Q1a7

References

External links

See also

ca:Haplogrup Q del cromosoma Y humà de:Haplogruppe Q (Y-DNA) fr:Haplogroupe Q (Y-ADN)





Source: Wikipedia | The above article is available under the GNU FDL. | Edit this article



Related Links in Haplogroup Q (Y-DNA)

Search for Haplogroup Q (Y-DNA) in Tutorials
Search for Haplogroup Q (Y-DNA) in Encyclopedia
Search for Haplogroup Q (Y-DNA) in Dictionary
Search for Haplogroup Q (Y-DNA) in Open Directory
Search for Haplogroup Q (Y-DNA) in Store
Search for Haplogroup Q (Y-DNA) in PriceGig


Help build the largest human-edited directory on the web.
Submit a Site - Open Directory Project - Become an Editor

Advertisement

Advertisement



Haplogroup Q (Y-DNA)
Haplogroup_Q_(Y-DNA) top Haplogroup_Q_(Y-DNA)

Home - Add TutorGig to Your Site - Disclaimer

©2008-2009 TutorGig.com. All Rights Reserved. Privacy Statement