Search: in
Haplogroup I (Y-DNA)
Haplogroup I (Y-DNA) in Encyclopedia Encyclopedia
  Tutorials     Encyclopedia     Dictionary     Directory  
Haplogroup_I_(Y-DNA) Email this to a friend      Haplogroup_I_(Y-DNA)

Haplogroup I (Y-DNA)

In human genetics, Haplogroup I is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ, itself a derivative of Haplogroup F.

Y-DNA Haplogroup I (the letter I, not the number 1) represents nearly one-fifth of the population of Europe. It can be found in most present-day European populations, with greatest density in Scandinavia, Bosnia and Herzegovina, Croatia and Sardinia. The haplogroup is almost non-existent outside of Europe, suggesting that it arose in Europe. Estimates of the age of Haplogroup I suggest that it arose prior to the Last Glacial Maximum. It may have been confined to refugia around the Black Sea and in the Balkans during the last Ice Age, and then spread northward during the recolonization of northern Europe following the retreat of the glaciers.

European LGM refuges, 20 kya.<!-- legend -->
<!-- legend -->
European LGM refuges, 20 kya.

Contents


Origins

The TMRCA (time to most recent common ancestor) for the I clade, expressed in ky (confidence interval), is 22.2 (15.3-30.0)[1], placing the Haplogroup I founding event approximately contemporaneous with the onset of the last glacial maximum (LGM) approximately 21 thousand years ago. Some speculate the initial dispersion of this population corresponds to the diffusion of the Gravettian culture.

Haplogroup I is closely related to Haplogroup J, which is today most common in Semitic and Northeast Caucasian peoples; both Haplogroup I and Haplogroup J have mutations in common making them descendants of Haplogroup IJ (S2, S22) which, however, split into I & J thousands of years before the emergence of semitic cultures, people or languages as they are historically attested to.

Note the TMRCA is an estimate of the time of subclade divergence. Rootsi et al. 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I, they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky. With these estimates, they are consistent with Karafet et al. 2008. A recent outlier is Underhill et al. 2007, which calculates the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky. This will need to be explained further, since they further calculate the STR variation age of I1 at only 8.1±1.5 ky.

Distribution

Rootsi et al. 2004 suggest that each of the ancestral populations now dominated by a particular subclade of Haplogroup I experienced an independent population expansion immediately after the ice age.

Haplogroup I Y-chromosomes have also been found among some populations of the Middle East, the Caucasus, and Central Asia, but they are found at frequencies exceeding 10% only among populations of Europe and Asia Minor, particularly among Germanic, Slavic, Uralic, and Turkic peoples, as well as among the Romance-speaking populations of France, Romania, Moldova, and Sardinia, the Albanian-speaking population of Albania, and the Greek-speaking population of Greece.

Within Europe, several populations are distinguished by having a significantly lower frequency of Haplogroup I than the surrounding populations: these depressions in the frequency of Haplogroup I distinguish the populations of Italy and Switzerland from Germany and Sardinia, Iberia from southern France and Normandy, Greece, Albania and the Slavic peoples, and the Baltic Latvians from the Finnic Estonians. In all these areas, Haplogroup I populations are small relative to the dominant European haplogroups (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe).

Subgroups

The subclades of Haplogroup I with their defining mutations[2]:

  • I (M170, P19, M258, P38, P212, U179)
    • I*
    • I1 (M253, M307, M450/S109, P30, P40, S62, S63, S64, S65, S66, S107, S108, S110, S111) (formerly I1a) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe
      • I1*
      • I1a (M21) (formerly I1a2)
      • I1b (M227) (formerly I1a1) Appears to be limited to a marginally low frequency of approximately 1% among Slavic and Uralic peoples of Eastern Europe; also detected in a single Lebanese man
        • I1b1 (M72) (formerly I1a1a)
      • I1c (P109)
      • I1d (P259)
    • I2 (M438/P215/S31) (formerly I1b)
      • I2*
      • I2a (P37.2) (formerly I1b1) Typical of the South Slavic peoples of the Balkans, especially the populations of Bosnia and Croatia; also found with high haplotype diversity values, but lower overall frequency, among the West Slavic populations of Slovakia and the Czech Republic; a node of elevated frequency in Moldavia correlates with that observed for Haplogroup I2a (but not for Haplogroup I1)
        • I2a*
        • I2a1 (M423)
          • I2a1*
          • I2a1a (P41.2/M359.2) (formerly I1b1a) Typical of the population of the so-called "archaic zone" of Sardinia; also found at low frequencies among populations of Southwest Europe, particularly in Castile, Béarn, and the Basque Country
        • I2a2 (M26) (formerly I1b1b)
          • I2a2*
          • I2a2a (M161) (formerly I1b1b1)
      • I2b (M436/P214/S33, P216/S30, P217/S23, P218/S32) (formerly I1b2)
        • I2b*
        • I2b1 (M223, P219/S24, P220/S119, P221/S120, P222/U250/S118, P223/S117) (formerly I1b2a - old I1c) Occurs at a moderate frequency among populations of Northwest Europe, with a peak frequency in the region of Lower Saxony in central Germany; minor offshoots appear in Moldavia and Russia (especially around Vladimir, Ryazan, Nizhny Novgorod, and the Republic of Mordovia)
          • I2b1*
          • I2b1a (M284) (formerly I1b2a1) Generally limited to a low frequency in Great Britain
          • I2b1b (M379) (formerly I1b2a2)
          • I2b1c (P78) (formerly I1b2a3)
          • I2b1d (P95) (formerly I1b2a4)

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer. Names from older literature which have now been superseded are listed in parentheses in the chart above.

I*

The composite subclade I* contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several haplogroup I* individuals, with some of the greatest Y-STR diversity, have significantly been found among the populations of Turkey (8/741), Adygea (2/138), and Iraq (1/176),even though as a whole Haplogroup I occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I* appear to be found among the Andalusians (3/103), French (4/179), Slovenians (2/55), and the Saami (1/35).http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1181996&rendertype=table&id=TB1

I1

Haplogroup I1 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. Notable exception is Finland, where frequency in West Finns is up to 40%, in certain provinces like Satakunta more than 50%.

Outside Fennoscandia, distribution of Haplogroup I1 is closely correlated with that of Haplogroup I2b; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I1. Another characteristic of the Scandinavian I1 Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I1 Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I1 among the modern French and Italian populations. Taken together, this suggests that the Haplogroup I element of the ancestry of Scandinavians might be descended from a very small Paleolithic population of Southern European extraction, which became distinct from the ancestral population of Haplogroup I1 individuals outside Scandinavia.

It is conjectured that this shared ancestral population of I1 and I2b, distinct from I2a*, may have weathered the last ice age in a refuge located somewhere in the Iberian Peninsula or southern France, or perhaps the Italian Peninsula; after the end of the ice age, some of them headed northward and repopulated Northwest Europe and Scandinavia. This population appears to have carried haplogroups I1 and I2b at significant frequencies, with a numerical superiority of Haplogroup I1. Their descendants are primarily found among the Germanic, Uralic, and Celtic populations of Northern Europe, although almost always overshadowed by the more prevalent carriers of Haplogroup R. If R is considered more specifically, as it is, split between R1b & R1a, then I1 shares almost equally the areas of population where it is at its peak frequencies.

I2a*

Haplogroup I2a* (P37.2) accounts for most of the Haplogroup I component in the Y-chromosome diversity of Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia and Bosnia-Herzegovina (40 - 50%).

The high frequency and diversity of Haplogroup I2a* among populations of the Western Balkans lends support to the hypothesis that the Adriatic region of modern-day Croatia served as a refuge for populations bearing Haplogroup I2a* during the last glacial maximum.

I2a1

Haplogroup I2a1a (M359), which is found outside of Sardinia only at low frequencies in Southwest Europe, accounts for almost all of the Haplogroup I Y-chromosomes, which comprise more than 40% of all patrilines among the Sardinians.

A distinct Western European Paleolithic population that bore Haplogroup I2a1 (M26) must have existed somewhere west of the Apennines in eastern Iberia, southern France, or western Italy, from which it succeeded in the first substantial colonization of the island of Sardinia approximately 9,000 years ago. Despite the fact that the predominantly Sardinian Haplogroup I2a1-M359 is derived from the predominantly Balkan Haplogroup I2a*-P37.2, the derived Haplogroup I2a1 is practically absent east of France and Italy, while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Thus, Haplogroup I2a1 appears to be strongly associated with Southwest Europeans of Paleolithic ancestry, and its carriers bear only a distant relictual relationship to the I2a*-bearing populations of the Balkans. It is also interesting that, although the distributions of Haplogroup I2a1 and the predominantly Scandinavian Haplogroup I1a overlap in parts of western France and the British Isles, and both haplogroups appear to have a very long history in Southwest Europe (and particularly France), the populations bearing these two haplogroups appear to have differentiated at a very early date and have not extensively mixed since that time. Haplogroup I2a1 appears to be the only subclade of Haplogroup I found among the Basques, although subclades of Haplogroup R1b comprise the vast majority of that people's Y-chromosome diversity. It is notable that Haplogroup I2a1 appears to be found at somewhat higher frequencies among the general populations of Castile in Spain and Béarn in France than among the population of ethnic Basques. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions like the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden. As of 2007, no specific study has confirmed this hypothesis, although the data in several previous studies (Rootsi, et al., Flores, et al., etc.) support this hypothesis.

I2b

The distribution of Haplogroup I2b (S23, S30, S32, S33) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1; the lack of correlation between the distributions of I1 and I2b in Fennoscandia may be a result of Haplogroup I2b's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I2b comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I2b has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I2b, namely I2b1 (M284), has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I1 and Haplogroup I2b seem to correlate fairly well with the extent of historical influence of Germanic peoples, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia.

Haplogroup I2b also occurs among approximately 1% of Sardinians.

Specifications of mutation

The technical details of U179 are:

Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5?? 3?: aaggggatatgacgactgatt
Reverse 5?? 3?: cagctcctcttttcaactctca

Testing Strategy

For Haplogroup I, STR testing, with at least 25 and preferably 40 or more alleles tested, will allow accurate inference of all currently known Haplogroup I subclade single nucleotide polymorphisms (SNP). It will also provide necessary resolution to help with identifying close relatives in family history time frames. Once the STR testing results are available, one should ensure they are posted in a public database for genealogy search as well as research purposes. Then, if the lab indicates you are Haplogroup I, compare the returned STR values to an existing table of compiled Haplogroup I haplotypes to determine your specific haplotype (go to http://www.isogg.org/tree/ISOGG_HapgrpI08.html and under Additional Resources, select the link to Modal Haplotypes for Y-Haplogroup I Varieties, then download FounderHaps.xls). Note that FTDNA values for your STR alleles should be used when comparing to this table. Note also that the previous version of subclade names are used. At this stage of Haplogroup I research, there is more resolution of sub-groups available through matching STR alleles with the listed haplotypes than is available via testing for known subclade SNPs. This has been the situation for a few years now, but hopefully may change when more people undergo SNP testing for some of the newer SNPs that are being discovered.

References

External links

Maps

Mailing Lists

Projects

Other

ca:Haplogrup I del cromosoma Y humà fr:Haplogroupe I (Y-ADN) it:Aplogruppo I (Y-DNA) ru:??????????? I





Source: Wikipedia | The above article is available under the GNU FDL. | Edit this article



Related Links in Haplogroup I (Y-DNA)

Search for tutorials in Haplogroup I (Y-DNA)
Search Encyclopedia for Haplogroup I (Y-DNA)
Search for Haplogroup I (Y-DNA) in TutorGig Dictionary
Search for Haplogroup I (Y-DNA) in Open Directory
Search for Haplogroup I (Y-DNA) in PriceGig



Help build the largest human-edited directory on the web.
Submit a Site - Open Directory Project - Become an Editor

Advertisement

Advertisement



Haplogroup I (Y-DNA) in Encyclopedia
Haplogroup_I_(Y-DNA) top Haplogroup_I_(Y-DNA)

Home - Add TutorGig to Your Site - Disclaimer

©2008-2009 TutorGig.com. All Rights Reserved. Privacy Statement